Entry information : BdiPrx119 (Bradi4g25660)
Entry ID 7885
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx119 (Bradi4g25660)
Name (synonym) BdiPrx119 (Bradi4g25660)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx119
start..stop
S start..stop
HvPrx18 529 0 13..327 7..321
HvPrx22 508 0 27..327 19..319
SiPrx111 489 4e-176 28..327 32..331
SbPrx83 488 1e-175 27..327 31..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31035538..31035771 234 N° 2 31034987..31035178 192 N° 3 31034643..31034808 166 N° 4 31033649..31034040 392
complement(join(31033649..31034040,31034643..31034808,31034987..31035178,3103553 8..31035771))


exon

Literature and cross-references BdiPrx119 (Bradi4g25660)
DNA ref. Phytozome 12:   Bd4 (31035771..31033649)
Protein sequence: BdiPrx119 (Bradi4g25660)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (296)
PWM (Da):   %s   34230.24 (31317.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.93 (7.70) Peptide Signal:   %s   cut: 32 range:32-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPGRNAVSTSVVLSCLLATLLLAAGSSSAQLSTGFYASSCPELLDAVRSALRPAVARERRVAASILRLFFHDCFVQGCDGSLLLDDASGLKGEKNAAPNKDSARGFDVVDAVKAAVEKACPGVVSCADVLAASAMEGVALLGGPRWKVKMGRRDSTTASFNGAENDIPPPTSGLANLTRLFAAKGLSQKDMVALSGAHTIGLARCTNFRDHIYNDTDIDAGFAGTLQQRCPRATGSGDNNLAPLDLQTPNVFENAYYKNLVAKKSLLHSDQELFNGGAADAQVREYVGSQSAFFADFVEGMVKMGDVTPLTGSNGQIRKNCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGCCGGGGAGAAATGCCGTGAGTACTAGTGTCGTCCTCAGCTGCCTCCTGGCGACCCTCCTGCTCGCCGCTGGAAGCTCCTCAGCTCAGCTGTCGACGGGCTTCTACGCCTCG
TCGTGCCCGGAGCTCCTCGACGCCGTGCGGTCGGCGCTCCGGCCGGCGGTGGCCCGGGAGCGGCGTGTGGCGGCGTCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCCAG
GTATAC
ATCAGTGATGATGCATGCATGAGGTCGATCGTCTCCACCACCACTGGGGTGGTGAGCTTGCTATATGCTACCACTTTTTCATAAATATAAGAAGTCTTTTCTCTTTGTCCTAAGTCAAAA
AAATTCGAGTTTGATCAAATTTATAGAAAAATTTATTAACATCTATAACTCCAAAATAGTTTTATTAAATCCCATCGGTCACTGCTTGATATTGTAGATCTTAATAGATTTTTATATAAA
TTTGGTTAAAAATTGAATAAGTTTGAGTTAGACAAAGCCAGAACTTCTTATGTTTACGAACGGATGTAGTATTAACCATCAATTAATGGCGGCTGCGACCACTGTGTGTGCAGGGCTGCG
ACGGGTCACTGCTGCTGGACGATGCGTCAGGGTTGAAGGGCGAGAAGAACGCAGCCCCGAACAAGGACTCCGCCAGAGGGTTTGATGTAGTCGACGCTGTCAAGGCCGCCGTCGAGAAGG
CCTGCCCCGGCGTCGTCTCCTGCGCCGACGTGCTCGCCGCCTCCGCCATGGAAGGCGTCGCCCTC
GTAAGCATAGCACACGTACTCCAATCCATGCATGTAGCTAGCAAGGATGTACTCC
CTCCGTCTCATATTAAATGATTTTCTGTTACATGTTTAGACAAATTTGAATCAATTAATATGTGACGGAGGGAGTATAAATTTGATTGCTTGAGCTGAAGGTGAAGCGTGTGTGTATGTG
TAGCTGGGCGGGCCGAGGTGGAAGGTAAAGATGGGGCGGAGGGACTCGACGACGGCGAGCTTCAACGGCGCAGAGAATGACATCCCACCGCCGACTTCCGGGCTCGCCAACCTCACCAGG
CTCTTCGCTGCTAAGGGCCTCTCACAGAAGGACATGGTCGCCCTCTCAG
GTATAATTTACATTCTAAATAATTTGTTCAATTAAGGCTGCTGAAATTACTGACTATATCATCTTACACTA
TAATTCCTTAGTTGAGAAAAGGCAAGCTTTTTCAAACCACTTCACAGTTCACACTGTTAATTCCTCACTGGAGGAGGCCAGTAGCTTTACTAGCTAGGAGTCCAAAACAGCTGGTATACA
TCAACCAACAGATTTTTGATAGCTATGTTTTGACTTTTGACAAACATTCTCAGTTGACAGGTTAATTAATTAAACAAATATGATTTACAAGTGATGAGACCGAAAGTTGGTGACTAACTA
CCTTTGACCTTAATTAACTTGTCGTTTGCTTTGCAAGACTCTAGCTGGACAAATAAACCAGCAAATTAATTCTCCTTTTTTTCTGGACTGAATCCAGCAAACTCTCCTTTCCTTTCTCAC
TAAACAAAACGTACAAATTAATTAATTAAGAAAGTTGGATAAGGATGGTTAATTATCTTTTCTGTTGGAACTTTCAGAGAATAGCTGTCCACAGAATGACATCAAAGGTAATTAAATATT
TAGTTGTCTCACACCACAGCTCTCTGTTTTTTGCCTCGATCTGACGTCCAGGAGCCCACACGATCGGCCTAGCACGCTGCACAAACTTCCGGGACCACATCTACAACGACACCGACATCG
ACGCCGGCTTCGCCGGAACCCTCCAGCAGAGGTGCCCCCGCGCCACCGGCTCCGGGGACAACAACTTGGCTCCACTAGACCTCCAGACCCCGAACGTCTTCGAGAACGCCTACTACAAGA
ACCTCGTCGCGAAGAAGAGCCTCTTACACTCGGACCAGGAGCTCTTCAATGGCGGCGCCGCTGACGCGCAGGTCCGGGAGTATGTCGGTAGCCAGAGCGCCTTCTTTGCAGACTTCGTGG
AGGGGATGGTGAAGATGGGTGACGTCACGCCGCTCACGGGGTCGAATGGGCAGATCAGGAAGAACTGTCGGAGGGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGCCGGGGAGAAATGCCGTGAGTACTAGTGTCGTCCTCAGCTGCCTCCTGGCGACCCTCCTGCTCGCCGCTGGAAGCTCCTCAGCTCAGCTGTCGACGGGCTTCTACGCCTCG
TCGTGCCCGGAGCTCCTCGACGCCGTGCGGTCGGCGCTCCGGCCGGCGGTGGCCCGGGAGCGGCGTGTGGCGGCGTCCATCCTCCGCCTCTTCTTCCACGACTGCTTCGTCCAG
GGCTGC
GACGGGTCACTGCTGCTGGACGATGCGTCAGGGTTGAAGGGCGAGAAGAACGCAGCCCCGAACAAGGACTCCGCCAGAGGGTTTGATGTAGTCGACGCTGTCAAGGCCGCCGTCGAGAAG
GCCTGCCCCGGCGTCGTCTCCTGCGCCGACGTGCTCGCCGCCTCCGCCATGGAAGGCGTCGCCCTC
CTGGGCGGGCCGAGGTGGAAGGTAAAGATGGGGCGGAGGGACTCGACGACGGCG
AGCTTCAACGGCGCAGAGAATGACATCCCACCGCCGACTTCCGGGCTCGCCAACCTCACCAGGCTCTTCGCTGCTAAGGGCCTCTCACAGAAGGACATGGTCGCCCTCTCAG
GAGCCCAC
ACGATCGGCCTAGCACGCTGCACAAACTTCCGGGACCACATCTACAACGACACCGACATCGACGCCGGCTTCGCCGGAACCCTCCAGCAGAGGTGCCCCCGCGCCACCGGCTCCGGGGAC
AACAACTTGGCTCCACTAGACCTCCAGACCCCGAACGTCTTCGAGAACGCCTACTACAAGAACCTCGTCGCGAAGAAGAGCCTCTTACACTCGGACCAGGAGCTCTTCAATGGCGGCGCC
GCTGACGCGCAGGTCCGGGAGTATGTCGGTAGCCAGAGCGCCTTCTTTGCAGACTTCGTGGAGGGGATGGTGAAGATGGGTGACGTCACGCCGCTCACGGGGTCGAATGGGCAGATCAGG
AAGAACTGTCGGAGGGTTAACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCCAGAGCTA GCACAGTGCA CTTAGCTAGC TTACTTTGCT CTCCATCATA CTACCAATCA TGGCGGCGCC GGGGAGAAAT GCCGTGAGTA CTAGTGTCGT CCTCAGCTGC CTCCTGGCGA  CCCTCCTGCT CGCCGCTGGA AGCTCCTCAG CTCAGCTGTC GACGGGCTTC TACGCCTCGT CGTGCCCGGA GCTCCTCGAC GCCGTGCGGT CGGCGCTCCG GCCGGCGGTG GCCCGGGAGC  GGCGTGTGGC GGCGTCCATC CTCCGCCTCT TCTTCCACGA CTGCTTCGTC CAGGGCTGCG ACGGGTCACT GCTGCTGGAC GATGCGTCAG GGTTGAAGGG CGAGAAGAAC GCAGCCCCGA  ACAAGGACTC CGCCAGAGGG TTTGATGTAG TCGACGCTGT CAAGGCCGCC GTCGAGAAGG CCTGCCCCGG CGTCGTCTCC TGCGCCGACG TGCTCGCCGC CTCCGCCATG GAAGGCGTCG  CCCTCCTGGG CGGGCCGAGG TGGAAGGTAA AGATGGGGCG GAGGGACTCG ACGACGGCGA GCTTCAACGG CGCAGAGAAT GACATCCCAC CGCCGACTTC CGGGCTCGCC AACCTCACCA  GGCTCTTCGC TGCTAAGGGC CTCTCACAGA AGGACATGGT CGCCCTCTCA GGAGCCCACA CGATCGGCCT AGCACGCTGC ACAAACTTCC GGGACCACAT CTACAACGAC ACCGACATCG  ACGCCGGCTT CGCCGGAACC CTCCAGCAGA GGTGCCCCCG CGCCACCGGC TCCGGGGACA ACAACTTGGC TCCACTAGAC CTCCAGACCC CGAACGTCTT CGAGAACGCC TACTACAAGA  ACCTCGTCGC GAAGAAGAGC CTCTTACACT CGGACCAGGA GCTCTTCAAT GGCGGCGCCG CTGACGCGCA GGTCCGGGAG TATGTCGGTA GCCAGAGCGC CTTCTTTGCA GACTTCGTGG  AGGGGATGGT GAAGATGGGT GACGTCACGC CGCTCACGGG GTCGAATGGG CAGATCAGGA AGAACTGTCG GAGGGTTAAC TAATTAACTA GTTTCTGTCA GAAAGCTAGC TGTTGTGATA  TGAATTATGA TATGGTTGTT TCCTGCCGTA TGATTCTGTT TCTGCAATTG TTAAGCTAAT TATGTATTGT GGCATGCTAG CTGCAAAGTG GTTTATATTG CTCGGTCGAG TGAAATGCAA 
TGGAAGTCCT AGAAGTATTG TGGAACCAA 

Retrieve as FASTA