Entry information : BdiPrx121 (Bradi4g32800)
Entry ID 7887
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-04-10 (Christophe Dunand)
Peroxidase information: BdiPrx121 (Bradi4g32800)
Name (synonym) BdiPrx121 (Bradi4g32800)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type Callus
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx121
start..stop
S start..stop
BdiPrx122 549 0 25..338 25..338
TmPrx07 528 0 26..347 22..343
TaPrx15 528 0 26..347 22..343
SiPrx121 528 0 7..347 3..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38553651..38553881 231 N° 2 38553350..38553541 192 N° 3 38552596..38553216 621  
complement(join(38552596..38553216,38553350..38553541,38553651..38553881))


exon

Literature and cross-references BdiPrx121 (Bradi4g32800)
Literature Vogel,J.P., Gu,Y.Q., Twigg,P., Lazo,G.R., Laudencia-Chingcuanco,D.,
Hayden,D.M., Donze,T.J., Vivian,L.A., Stamova,B. and Coleman-Derr,D.
EST sequencing and phylogenetic analysis of the model grass Brachypodium distachyon.
Theor Appl Genet 113 (2), 186-195 (2006).
DNA ref. Phytozome 12:   Bd4 (38553881..38552596)
EST ref. GenBank:   DV469205.1 [5' end]
Protein sequence: BdiPrx121 (Bradi4g32800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (320)
PWM (Da):   %s   37595.92 (34902.5)  
PI (pH):   %s   9.32 (9.48) Peptide Signal:   %s   cut: 28 range:28-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALGPHGRVSLLLAFAVSLAFVCPADGAVKELKAGYYGKTCPGAEETVRGVMARALAREPRGVASVMRLQFHDCFVNGCDGSVLMDATPTMAGEKESLSNINSIRSFEVVDQIKDALEKHCPGVVSCADIIVMAARDAVLLTGGPQWDVRLGREDSLTASRKASDDIMPSPRANASALIRLFAGYNLTVKDLVALSGSHSIGKARCFSVVTRLYNQSGSGRPDPHMDRAYRARMTALCPKGGDENVTVGMDATPVAFDNHYFKDLVRRRGFLNSDQTLFSDNARTRRLVGRFSKDQNAFFRAFAEGMIKMGELQNPNKGEIRRNCRVANGSPRAMEKQDVTSRGVHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, introns 1 and 2), 1 EST.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCTGTGCCAA CCTAAGAATG GTTTCAGATT TTGCTAACTG TTGTCTGTTG AGGATAATAG GTGTCTCCGA TCATTAGTTG ACCAGTCATA GCAAGCTTGC TTCGGGATCA GATACTGGGG  TTTGAGTTCG ACTAAAGCTG TCAGGCCAGG TAGGTTTTGA GGAACATTGG GGTTTTCCTT TTGCTGTGAC TGAGGATATG TCTATTGTGC CCGGTGAAAA AAAAAATTCA AGGAGTTTAC  CAAAGGCTTT CTCATTCGGA AAAATAATTT GAAGTATAGG AGTATTTCCC TTCTCCATTC TCTGCTCAGA GTATTTAAAG CCTTTCTCAT GGTACATCTC ATCGCTCACC TCATGAAAGA  GATCAATATA TTGTTGGGCT GATCCCTCCA CGTGGTGAGC TTCAGCCCAA TGAAGCCCAA AAACCAGCTC ATGTGAACCG TTGATTTCAG TCCAATCCAA CGGTTGAGAT ACCTCCTTGA  GAGAAAAGAG AAGAAGAACA AAACCCTAAC TACAACCAAA GAGAGGAGAG AGGAGAGGAA GATAAAATCT GTCCAGATTC GAGCTCCGTG TTGATCTTCA CCAAGTTTGT TCGTCGGAGG  CTCAAACGTG GTTGGATCAG CTCCAAATTG GTGAGTTTGT TCCACACTGA GAGCACTTCG ATTTGGTCCT TTGGTTGGAG GGTTAAGTGG TCAGAGAGCC GGATTAGTGA GTGGTTTCGT  CAGATCTGTT TGCTGGAACT TCAGAGATGC GCAATGTCGG GATATTGTCA GTTTGAGGGT TCAAACGATG TCGGATTGAG CTGAAATTTT AACAGCATGT TCAAGGCTCA CAGAGCTACA  TATGTGCCAA GTTTCATGCA TTTTGGTCCA GCCGTTTAAG AACAGTAATC TGAAAACCGA AGGGGACAGA AACCGCATTT ATCTGTTTAG CTGATTTTCA GTTGTATCAT TTTGCTCCTA  TTAAGAGTGC TTGTTGTTGA TGGTGATAGC AAGTTTGTAA CTTGTAATGG TGCTGTTGTG ATTCTCTAGA AGTTATAGAG AAGACCACGT TGTATCCATT TGTTAATAGT GGAAGTTGGA  GTAGAGCGGT CGGTCCCGTC GGTCACCTGT GCATGTGATT GTTTCTATTC GGTTGCTTAC TTGTTGGTTG AATCTATTCT CAAAATTCAT TGCAAGTTGA GGGGATTGTG ATTTTCTTTA  TTGCTGTCCC TGTTCCCAAC ATATATGTGG TCTGTGATTC GACACAGCAT GTATCTGTTC GAGCGTTTCA CAGGAATTGT GAAGTATACC ACATGTTTGG AGTCAGCATT GTCCACACGA  GAGCATTGTT GAATGATATA CTTAGAAGAG GTTGTTGAGC TCTTCGTGTA GCAAATCACC TAGCAACTTT CTCTTTGGCA AATTTTGGTG GTGCCCTCGT GTGACTGTGC CAAAAATTTG  GTCGCATTTA ATGAGCTCTA AAACCCGAAA AATCATGCAT GTCCTATAGT CCAATTTCAT TACCTGGTTT CCCGGATCGC CCTGCCTATG AATACAAGGC GGGCCCTCTC ACGGGGTCGT  ACTACTGCAG TACGGTACTC CCTCCGTCCG CCTATATGAG GCGTCCTAGT ATTTGCACAC ATATCAAGGA GCTGAAAACA ACGCGTTTGC TGCCTTGTAA AATTCCTCTT TTAGCCCAGC  ATGCTAGCTT TTTTAATCTG GCTTGGACCA ACCACATTGG CCACAGCAAT ACTTGCATGC AGTGATTGGT CACATGGGCT GATAATATTT AATGCATGCA GCAACTCAAG TCACCAGGCC  GAGGGTATTT TCGAGAGGAG TCTGACAAAA GGGTACCACA CCTTGTATGG ATGGACTGCG GGATTTGAAT TAAGCGCCCA GTGAAAAGGG CCGGAGGGAG TACTACGCTG TCTCTCCTCA 
TAGCAGAGCC GAATCTGAGC CCCATCTCAC TGCGTGTCAG TCAGTGGTGT GCGTTCTGTT CTGCCCTGCC GTCACACACA CC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTCGGCCCCCATGGCCGCGTCAGCTTGCTCCTCGCCTTTGCCGTGTCGCTCGCGTTCGTATGCCCCGCCGACGGGGCCGTGAAGGAGCTGAAGGCCGGGTACTACGGCAAGACT
TGCCCCGGCGCCGAGGAGACCGTCCGCGGCGTCATGGCCCGCGCGCTCGCCCGCGAGCCTCGCGGCGTCGCCTCCGTCATGCGCCTCCAGTTCCATGACTGCTTCGTCAAC
GTGAGTATA
TACCCGATTCTCACGTGGTTCTATTCCATCACGGAGTAGTCGTGAAGTTGCGCTGCGTGGTCTCTCATGGATTCTCCTCTGTTGGATCGTTTTCTCCAAGGGATGCGACGGGTCGGTGCT
GATGGACGCGACGCCGACGATGGCGGGGGAAAAGGAGTCGCTGTCTAACATCAACTCGATCCGGTCGTTCGAGGTCGTCGACCAGATCAAGGACGCGCTGGAGAAGCACTGCCCCGGCGT
CGTCTCCTGCGCCGACATCATCGTCATGGCCGCCCGCGACGCCGTTTTGCTG
GTATACGTCTACCTCTTTGTTTTATCTGACCAACGTGTAATAAGTTGAAGTAGTACTCCAGCTGTAAA
AAAAGGACTCCTAGTTGATTTGGTTTGACTGGCTCTGACTCTTTTTTTTTTCTCTTTTCACACAGACGGGTGGACCCCAGTGGGACGTGAGGCTCGGGCGCGAGGACAGCCTGACGGCGA
GCCGGAAGGCCTCCGACGACATCATGCCGAGCCCGCGCGCCAACGCCAGCGCGCTCATCCGCCTCTTCGCCGGATACAACCTCACCGTAAAAGACCTCGTCGCGCTCTCGGGCTCGCACT
CCATCGGCAAGGCCCGCTGCTTCTCCGTCGTCACCCGCCTCTACAACCAGTCGGGCTCCGGCCGGCCGGACCCCCACATGGACCGGGCCTATCGCGCCAGGATGACCGCGCTCTGCCCCA
AGGGCGGCGACGAGAACGTCACCGTCGGCATGGACGCCACTCCCGTCGCCTTCGACAATCATTACTTCAAGGACCTCGTCCGCCGTCGAGGGTTCTTGAACTCTGACCAGACGCTCTTCT
CCGACAACGCTAGGACCCGGCGGCTCGTGGGACGGTTCAGCAAGGACCAGAATGCCTTCTTCAGGGCCTTCGCTGAAGGGATGATCAAGATGGGCGAGCTCCAGAACCCCAACAAGGGAG
AGATACGGCGGAACTGTCGCGTCGCCAACGGTTCGCCGCGTGCGATGGAGAAGCAGGACGTGACATCCCGGGGTGTGCACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTCGGCCCCCATGGCCGCGTCAGCTTGCTCCTCGCCTTTGCCGTGTCGCTCGCGTTCGTATGCCCCGCCGACGGGGCCGTGAAGGAGCTGAAGGCCGGGTACTACGGCAAGACT
TGCCCCGGCGCCGAGGAGACCGTCCGCGGCGTCATGGCCCGCGCGCTCGCCCGCGAGCCTCGCGGCGTCGCCTCCGTCATGCGCCTCCAGTTCCATGACTGCTTCGTCAAC
GGATGCGAC
GGGTCGGTGCTGATGGACGCGACGCCGACGATGGCGGGGGAAAAGGAGTCGCTGTCTAACATCAACTCGATCCGGTCGTTCGAGGTCGTCGACCAGATCAAGGACGCGCTGGAGAAGCAC
TGCCCCGGCGTCGTCTCCTGCGCCGACATCATCGTCATGGCCGCCCGCGACGCCGTTTTGCTG
ACGGGTGGACCCCAGTGGGACGTGAGGCTCGGGCGCGAGGACAGCCTGACGGCGAGC
CGGAAGGCCTCCGACGACATCATGCCGAGCCCGCGCGCCAACGCCAGCGCGCTCATCCGCCTCTTCGCCGGATACAACCTCACCGTAAAAGACCTCGTCGCGCTCTCGGGCTCGCACTCC
ATCGGCAAGGCCCGCTGCTTCTCCGTCGTCACCCGCCTCTACAACCAGTCGGGCTCCGGCCGGCCGGACCCCCACATGGACCGGGCCTATCGCGCCAGGATGACCGCGCTCTGCCCCAAG
GGCGGCGACGAGAACGTCACCGTCGGCATGGACGCCACTCCCGTCGCCTTCGACAATCATTACTTCAAGGACCTCGTCCGCCGTCGAGGGTTCTTGAACTCTGACCAGACGCTCTTCTCC
GACAACGCTAGGACCCGGCGGCTCGTGGGACGGTTCAGCAAGGACCAGAATGCCTTCTTCAGGGCCTTCGCTGAAGGGATGATCAAGATGGGCGAGCTCCAGAACCCCAACAAGGGAGAG
ATACGGCGGAACTGTCGCGTCGCCAACGGTTCGCCGCGTGCGATGGAGAAGCAGGACGTGACATCCCGGGGTGTGCACTTCTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCGAATCTGA GCCCCATCTC ACTGCGTGTC AGTCAGTGGT GTGCGTTCTG TTCTGCCCTG CCGTCACACA CACCATGGCG CTCGGCCCCC ATGGCCGCGT CAGCTTGCTC CTCGCCTTTG  CCGTGTCGCT CGCGTTCGTA TGCCCCGCCG ACGGGGCCGT GAAGGAGCTG AAGGCCGGGT ACTACGGCAA GACTTGCCCC GGCGCCGAGG AGACCGTCCG CGGCGTCATG GCCCGCGCGC  TCGCCCGCGA GCCTCGCGGC GTCGCCTCCG TCATGCGCCT CCAGTTCCAT GACTGCTTCG TCAACGGATG CGACGGGTCG GTGCTGATGG ACGCGACGCC GACGATGGCG GGGGAAAAGG  AGTCGCTGTC TAACATCAAC TCGATCCGGT CGTTCGAGGT CGTCGACCAG ATCAAGGACG CGCTGGAGAA GCACTGCCCC GGCGTCGTCT CCTGCGCCGA CATCATCGTC ATGGCCGCCC  GCGACGCCGT TTTGCTGACG GGTGGACCCC AGTGGGACGT GAGGCTCGGG CGCGAGGACA GCCTGACGGC GAGCCGGAAG GCCTCCGACG ACATCATGCC GAGCCCGCGC GCCAACGCCA  GCGCGCTCAT CCGCCTCTTC GCCGGATACA ACCTCACCGT AAAAGACCTC GTCGCGCTCT CGGGCTCGCA CTCCATCGGC AAGGCCCGCT GCTTCTCCGT CGTCACCCGC CTCTACAACC  AGTCGGGCTC CGGCCGGCCG GACCCCCACA TGGACCGGGC CTATCGCGCC AGGATGACCG CGCTCTGCCC CAAGGGCGGC GACGAGAACG TCACCGTCGG CATGGACGCC ACTCCCGTCG  CCTTCGACAA TCATTACTTC AAGGACCTCG TCCGCCGTCG AGGGTTCTTG AACTCTGACC AGACGCTCTT CTCCGACAAC GCTAGGACCC GGCGGCTCGT GGGACGGTTC AGCAAGGACC  AGAATGCCTT CTTCAGGGCC TTCGCTGAAG GGATGATCAA GATGGGCGAG CTCCAGAACC CCAACAAGGG AGAGATACGG CGGAACTGTC GCGTCGCCAA CGGTTCGCCG CGTGCGATGG  AGAAGCAGGA CGTGACATCC CGGGGTGTGC ACTTCTGATC ACCGAGGTCT GAGAGGTCAG AAGTGCGTAC ATATAATAAA GGTTTCAGAT CTAACTACCG ATTATTGCTA ATTGTTGAGG 
AATAATAGAG ACTTCAATGC CTCTGCTGCA TCAAGGTTTG G 

Retrieve as FASTA