Entry information : BdiPrx122(Bradi4g32810)
Entry ID 7888
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-10-02 (Christophe Dunand)
Peroxidase information: BdiPrx122(Bradi4g32810)
Name BdiPrx122(Bradi4g32810)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx122
start..stop
S start..stop
TmPrx07 570 0 143..456 22..335
TaPrx15 570 0 143..456 22..335
BdiPrx121 562 0 121..455 5..338
OsPrx122 555 0 140..456 31..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38558449..38559030 582 N° 2 38558114..38558305 192 N° 3 38555982..38556608 627  
complement(join(38555982..38556608,38558114..38558305,38558449..38559030))


exon

Literature and cross-references BdiPrx122(Bradi4g32810)
DNA ref. Phytozome 12:   Bd4 (38558679..38555982)
Protein sequence: BdiPrx122(Bradi4g32810)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   466 (322)
PWM (Da):   %s   50712.49 (35107.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.45 (5.43) Peptide Signal:   %s   cut: 28 range:28-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSNSEHRAGGRRTKRPTWPRRTNRRRNPVPLALPSHQHHWLCASAFPFQPASRCLCPCGRVPFLYNHRQGPAFPSLLYQLLVRCHGRRISGATAALPLPSSLFPFASCSALPPSPPMAHPRGGVCPLLSLAVSLALLCGGADAALRELEVGYYARTCPGAEEIVRGVMARALSREPRSVASVMRLQFHDCFVNGCDGSVLMDATPTVPGEKEALSNINSLRSFEVVDQVKEALEEHCPGVVSCADIIVMASRDAVVLTGGPRWDVRLGREDSLTASQEDSDNIMPSPRANASTLIRLFAGYNLTITDLVALSGSHSIGQARCFSIVFRLYNQSGSGRPDPHMDPAYRAKLDALCPLGGDEEVTGGMDATPIVFDNQYFKDLVHLRGFLNSDQTLFSDNAGTRQVVAKFSEDQDAFFRAFADGMVKMGELQNPRKGEIRRNCRVANGSPSPRHKQVLLVQSLVQDY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, intron 1 and 2), no EST., but proteomic data to confirm the long PS.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TAATGTATGC ATTTTGATAT CCTACGTAGC CATTTTTATG TGAACATAAG CTGAGGGGCT GCTTGTCTTT GCATGATATC TCACTTGATT GGTCTCAGAA TGTGGAGTGC TAGATGGGTC  TCTTTTCCTG TATCAGTTTC ATTCCCATGC AGTTCTTTGG TTTATTGTTG TCAAGTTATT ACTTTGATTC TCATCTGTTG AGTGCACATT GCACCTGATC TTTCCTAATG AATCTCTCTT  AGTGTCAGTT TGGTGTTAGA GGGCGGACAT GGCAGCGGTG TACGTATGGC CTCAGCAGAA ACTCCTGGAT GAAATTAATT TTGCATAAAA GATACTAAAT GCAAAAAAAG TCCGTAATGC  CCTGGAAAAT GAAGGATGAG ATTGAATGTA CACTACTCTC TCCTTCAGGA GTGGATATGG GAGATTTTGG TTGGGTGAGG AAACAGGTAC TCCCTCCGTC CTAATATACC AGGCGTTTTA  GAAATCTTAT TTCAACAATT GAAATCTGTT GAGGAATGCA AGATGGGATC AGAGTCGTCA CTCATGATTC ATGAATAGTG ACATGCCCGC TGATGTTGGT AGGATGGTCT AGGAACCGTT  AGCAAATAAG ACGAGTAGTA CAGCATGGCT GTCAATTTAA AGATGACAAC TGAATGGTTC TAGGTACAAC ATGGCCTAGT GTACATATAT GATCTTTTCC TTAATTGTCA AAAAATTTAA  CAACAAAATC AAAACCTTTC ATCCATAAAA TCAAAACTTA GCACATCTTC AAATTTGACT TTCCTTAACT TTATATCTGA AGTGGATGCT TTACTAAGAA CTAGTCGTCC TCTTCTAAAA  ATACAACGGT TCCACCTCCA TCATCACCCG TCTTCGCCGG TAGATCGCTG ATTTCTCCTC CTCCACCAGC GTCTAAGAAA TTTCTGATCT CCGATGGGAG CTGTAGTTTT CATTATGTGT  GTGAGTCGGT GTTAGGTTTT TCAGATCGAT TCAAGGGTTC AACAAATGGC GACCGCGGCG TCGTGACGCA GATCCTCAAG GGCACGTGCA CACTGACTTC CCGTTTGTCA TTGACTAGGT  TAAACCAGCT CCGAAAGCGG AGTGGTGACG GTGGCGTGTC ATCGGCTTGT TTTGCCGGCT GTAGTGCGTC TGGATCAAAA TATGGCTTTT AAATTAAGTT TCGAATTAGT AGATGCTACC  AAAAAGAGTG AAGGTGCCAT ACGCAAAAAG GAAACGACTC ATAAAATGGT AGAGGTAAAG GGCTCTTGCA CATTTTCGTT AATCCAATGA CTATGTACGT AGACAGATGG ATTCGTATAT  ATCGATCGGA AAAGAATCAA TAGAAAGGAG AATGGGACGA TATTTTTCTC GACATCTAAG CTGCAAAGAA TTGATCAACT TTTTTCTAGA GGTAGAATTG ATCAACTAGT GAGCAAACAT  TGCACGGAGA AAATTGATCG TCCCAATCCT AACTCGTGGC ACCGCCGCAG CACTCACCCG GTACCACAGC TATAGCTACA GCCCACAGCC AGAGTCATGT ATGGACGAGG GGCACGCCGA  AAAGTCCAAG TCAATGCTCC CCTTTTCCCG GGCCATCGCC GGCAGTGCCG TCCTATCACA AGGTCGATCC CCGCGGATAT TTTTGACGCA TGCTTTCCAA CAGCGAGCAC CGGGCCGGAG  GCCGGAGGAC CAAAAGGCCC ACATGGCCGC GCCGCACTAA TCGTCGTCGT AATCCCGTAC CTTTGGCCCT TCCGTCCCAC CAGCACCATT GGCTCTGCGC CTCTGCTTTC CCCTTCCAGC  CTGCATCGCG TTGCCTTTGC CCGTGTGGCC GTGTCCCCTT TCTATATAAC CACCGGCAGG GGCCGGCCTT CCCGAGTTTA CTCTATCAAC TACTGGTACG CTGCCACGGC AGAAGAATCT 
CAGGAGCAAC CGCAGCGCTG CCACTGCCCT CTTCTCTCTT CCCCTTCGCG TCCTGCTCTG CTCTCCCCCC TTCGCCACCC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCCAACAGCGAGCACCGGGCCGGAGGCCGGAGGACCAAAAGGCCCACATGGCCGCGCCGCACTAATCGTCGTCGTAATCCCGTACCTTTGGCCCTTCCGTCCCACCAGCACCAT
TGGCTCTGCGCCTCTGCTTTCCCCTTCCAGCCTGCATCGCGTTGCCTTTGCCCGTGTGGCCGTGTCCCCTTTCTATATAACCACCGGCAGGGGCCGGCCTTCCCGAGTTTACTCTATCAA
CTACTGGTACGCTGCCACGGCAGAAGAATCTCAGGAGCAACCGCAGCGCTGCCACTGCCCTCTTCTCTCTTCCCCTTCGCGTCCTGCTCTGCTCTCCCCCCTTCGCCACCCATGGCGCAC
CCCCGCGGCGGCGTCTGCCCGCTCCTCTCCCTCGCCGTGTCCCTCGCGCTCCTGTGCGGCGGCGCCGACGCGGCCTTGAGGGAGCTGGAGGTCGGGTACTACGCCCGGACGTGCCCCGGC
GCGGAGGAGATCGTGCGCGGGGTCATGGCCCGCGCGCTCTCACGCGAGCCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GTGAGTACTTCTCTTCCC
CTCCCCCACCTGCCTGCGTCCGCGATCCCCGTCTCGCTCCACGGCTCTGCTTGCTGTTTACTACCACGCCACGGGGTGGTCTCTCATCGATTTCGATCGGCCGCGATTTTCTCTTGTGGC
TCCAGGGATGCGACGGGTCGGTGCTGATGGACGCGACGCCGACGGTGCCGGGGGAGAAGGAGGCGCTGTCCAACATCAACTCCCTCCGCTCGTTCGAGGTCGTCGACCAGGTCAAGGAGG
CGTTGGAGGAGCACTGCCCCGGCGTCGTCTCCTGCGCCGACATCATCGTCATGGCCTCTCGCGACGCCGTCGTCCTG
GTACGAACCCCCTCCCCAGGCTCGCCTCCATCTACGCGACGAC
ACGGGGACGATCTGTATGCCCTGTGTTTAATTATTGCATCGGTGAATCTAGCTTACATACGTGCCCTGCCTTATCGTGCGGCAAGATACACGCGAGGGCAATCGGACGACCAAGCTCTTT
TCCTCTTAATATTTGTGAAACCTATAGATTAAAATTAGATTCTAAACTACTCTGCGTACGACACAATTCATACGATTTCTGTGATGTATTGATTTTTGCTTCGCCCAGAGGCCCAAACCT
AGGTGCCTTGAAGTGGTCCTGTTCCTCGCAACAATCAGCAAGCGTTTTTTCACAGTTCAATCAACGGGAGCTGTCCCGTCGAAAGAGTGACGGAAGTCCAAATAATTAGTAATGCATTAC
CTAAATAAATAGACCAAATTACCCTTACAAATGGATGTCTAGATTTGTTTGGTACTCTTGCCTTTTTTTGTCAAAAGGGGGAAGAAACAAAGGGAGAAACTGAAGTTCGAAATTGCTTCA
CTAGTTCTCTATTTTGTCCGTTAATACTTCTGTCTCGCTGTGGGTGGGCCCCGACGGCACCTACCTATGCTCAGCGTCTCTCGCACGCAGAGTCTTCGCATTGCTCTTTTTCTTCCAGGT
TCGTACGCAGAATCGCCGAGACATCTGAGTTCACAGCTGAACTTTTATTTGGGTTGGCACTCTACGCCGTACCAGAAAGTAGAAACAAATGCACAATCGCACGAATCGTTTAGGAAGTGC
TAATTGTTTTCTGAAATCGCGAGGCCAAATGTTCGGAAGAAAATAGGGGGCTATGACAGGGACGGCGCATGTGTGCCTTGCTCCCTCAAACGACCACACGAAACAAGAAGCGGGCGAGGA
TGGCGTCACCTCCTCCATCCTTCGCCTGCACATGATTCCCCGTAGGCAGGCAGGTGCATTTAAAGAGGGGGCCTCGCCTACGAAAGGGCCAACAGCCAGAGCTGCAGCCTGCAGGTATAG
TGGCCCTGTACGTATATCATGCCGGCAGCCGTACCCTGCCTTTTGCTGTCAAACTGGTCCTTGACTCCTTTGCCAGCAGGAATAGCAAGGGAAGTAGTAGTAGAGAGTAAACGAGATTTT
TTTGGTACTTCGTCTGCTTCCTTGTTCCTTTGGGAGCGTGTCGCCGTGCCAGCCATTCGTTTTCTTTTCTCGGCGAGATTCGGGATGGTTCATTGGTGCATGCAAGAGGGGGGCTAATGC
TGTTCTCGGATTATTCGATTATTTCAGTTACGCTTTGAGTTTGTCGTACTTGCTCTCTTGGAATCATAAATGAGCATTACGCTTTGAGTTTGTCGTACTTGCGCTCTCACAATGGTCATT
AATTTATGCACGAACTGAGTAAATTAAAATAGCCCAGTAAGTGAGACAAGTTTGTTTGACTTCGTTTGACTCTTTACAATCAAACAGTCAAAGGAAAAGGCTTCGTTTGACTCTGATTCT
CCTTAATTTTCTCTCCCAACAGACCGGCGGACCCCGTTGGGACGTGAGGCTTGGGCGCGAGGACAGCCTGACGGCGAGCCAGGAGGACTCGGACAACATCATGCCGAGCCCGCGCGCCAA
CGCGAGCACCCTCATCCGCCTCTTTGCCGGCTACAACCTCACCATCACCGACCTCGTCGCGCTCTCTGGCTCACACTCCATCGGTCAGGCCCGCTGCTTCTCCATCGTCTTCCGCCTATA
CAACCAGTCGGGCTCCGGTCGGCCTGACCCCCACATGGACCCAGCCTACCGCGCCAAGCTCGACGCGCTTTGCCCCCTGGGCGGCGATGAGGAAGTCACCGGCGGCATGGACGCCACCCC
GATCGTCTTCGACAACCAGTACTTCAAGGACCTCGTCCACCTCCGGGGGTTCTTGAACTCAGACCAGACGCTCTTCTCTGACAACGCCGGTACTCGCCAGGTGGTGGCAAAGTTCAGCGA
GGATCAGGACGCCTTCTTCAGGGCCTTCGCTGATGGCATGGTCAAGATGGGAGAGCTCCAGAACCCAAGGAAGGGGGAGATACGACGCAACTGCCGCGTCGCCAACGGCTCACCATCTCC
GAGGCACAAGCAGGTCCTGCTCGTGCAGTCCCTGGTGCAGGACTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTTCCAACAGCGAGCACCGGGCCGGAGGCCGGAGGACCAAAAGGCCCACATGGCCGCGCCGCACTAATCGTCGTCGTAATCCCGTACCTTTGGCCCTTCCGTCCCACCAGCACCAT
TGGCTCTGCGCCTCTGCTTTCCCCTTCCAGCCTGCATCGCGTTGCCTTTGCCCGTGTGGCCGTGTCCCCTTTCTATATAACCACCGGCAGGGGCCGGCCTTCCCGAGTTTACTCTATCAA
CTACTGGTACGCTGCCACGGCAGAAGAATCTCAGGAGCAACCGCAGCGCTGCCACTGCCCTCTTCTCTCTTCCCCTTCGCGTCCTGCTCTGCTCTCCCCCCTTCGCCACCCATGGCGCAC
CCCCGCGGCGGCGTCTGCCCGCTCCTCTCCCTCGCCGTGTCCCTCGCGCTCCTGTGCGGCGGCGCCGACGCGGCCTTGAGGGAGCTGGAGGTCGGGTACTACGCCCGGACGTGCCCCGGC
GCGGAGGAGATCGTGCGCGGGGTCATGGCCCGCGCGCTCTCACGCGAGCCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GGATGCGACGGGTCGGTG
CTGATGGACGCGACGCCGACGGTGCCGGGGGAGAAGGAGGCGCTGTCCAACATCAACTCCCTCCGCTCGTTCGAGGTCGTCGACCAGGTCAAGGAGGCGTTGGAGGAGCACTGCCCCGGC
GTCGTCTCCTGCGCCGACATCATCGTCATGGCCTCTCGCGACGCCGTCGTCCTG
ACCGGCGGACCCCGTTGGGACGTGAGGCTTGGGCGCGAGGACAGCCTGACGGCGAGCCAGGAGGAC
TCGGACAACATCATGCCGAGCCCGCGCGCCAACGCGAGCACCCTCATCCGCCTCTTTGCCGGCTACAACCTCACCATCACCGACCTCGTCGCGCTCTCTGGCTCACACTCCATCGGTCAG
GCCCGCTGCTTCTCCATCGTCTTCCGCCTATACAACCAGTCGGGCTCCGGTCGGCCTGACCCCCACATGGACCCAGCCTACCGCGCCAAGCTCGACGCGCTTTGCCCCCTGGGCGGCGAT
GAGGAAGTCACCGGCGGCATGGACGCCACCCCGATCGTCTTCGACAACCAGTACTTCAAGGACCTCGTCCACCTCCGGGGGTTCTTGAACTCAGACCAGACGCTCTTCTCTGACAACGCC
GGTACTCGCCAGGTGGTGGCAAAGTTCAGCGAGGATCAGGACGCCTTCTTCAGGGCCTTCGCTGATGGCATGGTCAAGATGGGAGAGCTCCAGAACCCAAGGAAGGGGGAGATACGACGC
AACTGCCGCGTCGCCAACGGCTCACCATCTCCGAGGCACAAGCAGGTCCTGCTCGTGCAGTCCCTGGTGCAGGACTACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACGCCGAAAA GTCCAAGTCA ATGCTCCCCT TTTCCCGGGC CATCGCCGGC AGTGCCGTCC TATCACAAGG TCGATCCCCG CGGATATTTT TGACGCATGC TTTCCAACAG CGAGCACCGG  GCCGGAGGCC GGAGGACCAA AAGGCCCACA TGGCCGCGCC GCACTAATCG TCGTCGTAAT CCCGTACCTT TGGCCCTTCC GTCCCACCAG CACCATTGGC TCTGCGCCTC TGCTTTCCCC  TTCCAGCCTG CATCGCGTTG CCTTTGCCCG TGTGGCCGTG TCCCCTTTCT ATATAACCAC CGGCAGGGGC CGGCCTTCCC GAGTTTACTC TATCAACTAC TGGTACGCTG CCACGGCAGA  AGAATCTCAG GAGCAACCGC AGCGCTGCCA CTGCCCTCTT CTCTCTTCCC CTTCGCGTCC TGCTCTGCTC TCCCCCCTTC GCCACCCATG GCGCACCCCC GCGGCGGCGT CTGCCCGCTC  CTCTCCCTCG CCGTGTCCCT CGCGCTCCTG TGCGGCGGCG CCGACGCGGC CTTGAGGGAG CTGGAGGTCG GGTACTACGC CCGGACGTGC CCCGGCGCGG AGGAGATCGT GCGCGGGGTC  ATGGCCCGCG CGCTCTCACG CGAGCCCCGC AGCGTCGCCT CCGTCATGCG CCTCCAGTTC CACGACTGCT TCGTCAACGG ATGCGACGGG TCGGTGCTGA TGGACGCGAC GCCGACGGTG  CCGGGGGAGA AGGAGGCGCT GTCCAACATC AACTCCCTCC GCTCGTTCGA GGTCGTCGAC CAGGTCAAGG AGGCGTTGGA GGAGCACTGC CCCGGCGTCG TCTCCTGCGC CGACATCATC  GTCATGGCCT CTCGCGACGC CGTCGTCCTG ACCGGCGGAC CCCGTTGGGA CGTGAGGCTT GGGCGCGAGG ACAGCCTGAC GGCGAGCCAG GAGGACTCGG ACAACATCAT GCCGAGCCCG  CGCGCCAACG CGAGCACCCT CATCCGCCTC TTTGCCGGCT ACAACCTCAC CATCACCGAC CTCGTCGCGC TCTCTGGCTC ACACTCCATC GGTCAGGCCC GCTGCTTCTC CATCGTCTTC  CGCCTATACA ACCAGTCGGG CTCCGGTCGG CCTGACCCCC ACATGGACCC AGCCTACCGC GCCAAGCTCG ACGCGCTTTG CCCCCTGGGC GGCGATGAGG AAGTCACCGG CGGCATGGAC  GCCACCCCGA TCGTCTTCGA CAACCAGTAC TTCAAGGACC TCGTCCACCT CCGGGGGTTC TTGAACTCAG ACCAGACGCT CTTCTCTGAC AACGCCGGTA CTCGCCAGGT GGTGGCAAAG  TTCAGCGAGG ATCAGGACGC CTTCTTCAGG GCCTTCGCTG ATGGCATGGT CAAGATGGGA GAGCTCCAGA ACCCAAGGAA GGGGGAGATA CGACGCAACT GCCGCGTCGC CAACGGCTCA  CCATCTCCGA GGCACAAGCA GGTCCTGCTC GTGCAGTCCC TGGTGCAGGA CTACTAATCC ACGGGAGGTC TGTATCCTGT AGATGTCTCC TGATAGCTGT GATGTGAAAC TGAAAATGAC  GGATGTGTTT GACATAGTTT TGGTTGTCTC GCAGTTCTGT GCCAACCTAA GAATGGTTTC AGATTTTGCT AACTGTTGTC TGTTGAGGAT AATAGGTGTC TCCGATCATT AGTTGACCAG  TCATAGCAAG CTTGCTTCGG GATCAGATAC TGGGGTTTGA GTTCGACTAA AGCTGTCAGG CCAGGTAGGT TTTGAGGAAC ATTGGGGTTT TCCTTTTGCT GTGACTGAGG ATATGTCTAT  TGTGCCCGGT GAAAAAAAAA ATTCAAGGAG TTTACCAAAG GCTTTCTCAT TCGGAAAAAT AATTTGAAGT ATAGGAGTAT TTCCCTTCTC CATTCTCTGC TCAGAGTATT TAAAGCCTTT  CTCATGGTAC ATCTCATCGC TCACCTCATG AAAGAGATCA ATATATTGTT GGGCTGATCC CTCCACGTGG TGAGCTTCAG CCCAATGAAG CCCAAAAACC AGCTCATGTG AACCGTTGAT  TTCAGTCCAA TCCAACGGTT GAGATACCTC CTTGAGAGAA AAGAGAAGAA GAACAAAACC CTAACTACAA CCAAAGAGAG GAGAGAGGAG AGGAAGATAA AATCTGTCCA GATTCGAGCT  CCGTGTTGAT CTTCACCAAG TTTGTTCGTC GGAGGCTCAA ACGTGGTTGG ATCAGCTCCA AATTGGTGAG TTTGTTCCAC ACTGAGAGCA CTTCGATTTG GTCCTTTGGT TGGAGGGTTA  AGTGGTCAGA GAGCCGGATT AGTGAGTGGT TTCGTCAGAT CTGTTTGCTG GAACTTCAGA GATGCGCAAT GTCGGGATAT TGTCAGTTTG AGGGTTCAAA CGATGTCGGA TTGAGCTGAA  ATTTTAACAG CATGTTCAAG GCTCACAGAG CTACATATGT GCCAAGTTTC ATGCATTTTG GTCCAGCCGT TTAAGAACAG TAATCTGAAA ACCGAAGGGG ACAGAAACCG CATTTATCTG  TTTAGCTGAT TTTCAGTTGT ATCATTTTGC TCCTATTAAG AGTGCTTGTT GTTGATGGTG ATAGCAAGTT TGTAACTTGT AATGGTGCTG TTGTGATTCT CTAGAAGTTA TAGAGAAGAC 
CACGTTGTAT CCATTTGTTA ATAGTGGAAG TTGGAGTAGA GCGGTCGGTC CCGTCGGTCA CCTGTG 

Retrieve as FASTA