Entry information : BdiPrx122 (Bradi4g32810)
Entry ID 7888
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-04-10 (Christophe Dunand)
Peroxidase information: BdiPrx122 (Bradi4g32810)
Name (synonym) BdiPrx122 (Bradi4g32810)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx122
start..stop
S start..stop
TmPrx07 572 0 26..339 22..335
TaPrx15 572 0 26..339 22..335
BdiPrx121 564 0 4..338 5..338
OsPrx122 556 0 23..346 31..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38558449..38558679 231 N° 2 38558114..38558305 192 N° 3 38555982..38556608 627  
complement(join(38555982..38556608,38558114..38558305,38558449..38558679))


exon

Literature and cross-references BdiPrx122 (Bradi4g32810)
DNA ref. Phytozome 12:   Bd4 (38558679..38555982)
Protein sequence: BdiPrx122 (Bradi4g32810)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (322)
PWM (Da):   %s   37680.76 (35107.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.66 (5.43) Peptide Signal:   %s   cut: 28 range:28-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHPRGGVCPLLSLAVSLALLCGGADAALRELEVGYYARTCPGAEEIVRGVMARALSREPRSVASVMRLQFHDCFVNGCDGSVLMDATPTVPGEKEALSNINSLRSFEVVDQVKEALEEHCPGVVSCADIIVMASRDAVVLTGGPRWDVRLGREDSLTASQEDSDNIMPSPRANASTLIRLFAGYNLTITDLVALSGSHSIGQARCFSIVFRLYNQSGSGRPDPHMDPAYRAKLDALCPLGGDEEVTGGMDATPIVFDNQYFKDLVHLRGFLNSDQTLFSDNAGTRQVVAKFSEDQDAFFRAFADGMVKMGELQNPRKGEIRRNCRVANGSPSPRHKQVLLVQSLVQDY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, intron 1 and 2), no EST.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TAATGTATGC ATTTTGATAT CCTACGTAGC CATTTTTATG TGAACATAAG CTGAGGGGCT GCTTGTCTTT GCATGATATC TCACTTGATT GGTCTCAGAA TGTGGAGTGC TAGATGGGTC  TCTTTTCCTG TATCAGTTTC ATTCCCATGC AGTTCTTTGG TTTATTGTTG TCAAGTTATT ACTTTGATTC TCATCTGTTG AGTGCACATT GCACCTGATC TTTCCTAATG AATCTCTCTT  AGTGTCAGTT TGGTGTTAGA GGGCGGACAT GGCAGCGGTG TACGTATGGC CTCAGCAGAA ACTCCTGGAT GAAATTAATT TTGCATAAAA GATACTAAAT GCAAAAAAAG TCCGTAATGC  CCTGGAAAAT GAAGGATGAG ATTGAATGTA CACTACTCTC TCCTTCAGGA GTGGATATGG GAGATTTTGG TTGGGTGAGG AAACAGGTAC TCCCTCCGTC CTAATATACC AGGCGTTTTA  GAAATCTTAT TTCAACAATT GAAATCTGTT GAGGAATGCA AGATGGGATC AGAGTCGTCA CTCATGATTC ATGAATAGTG ACATGCCCGC TGATGTTGGT AGGATGGTCT AGGAACCGTT  AGCAAATAAG ACGAGTAGTA CAGCATGGCT GTCAATTTAA AGATGACAAC TGAATGGTTC TAGGTACAAC ATGGCCTAGT GTACATATAT GATCTTTTCC TTAATTGTCA AAAAATTTAA  CAACAAAATC AAAACCTTTC ATCCATAAAA TCAAAACTTA GCACATCTTC AAATTTGACT TTCCTTAACT TTATATCTGA AGTGGATGCT TTACTAAGAA CTAGTCGTCC TCTTCTAAAA  ATACAACGGT TCCACCTCCA TCATCACCCG TCTTCGCCGG TAGATCGCTG ATTTCTCCTC CTCCACCAGC GTCTAAGAAA TTTCTGATCT CCGATGGGAG CTGTAGTTTT CATTATGTGT  GTGAGTCGGT GTTAGGTTTT TCAGATCGAT TCAAGGGTTC AACAAATGGC GACCGCGGCG TCGTGACGCA GATCCTCAAG GGCACGTGCA CACTGACTTC CCGTTTGTCA TTGACTAGGT  TAAACCAGCT CCGAAAGCGG AGTGGTGACG GTGGCGTGTC ATCGGCTTGT TTTGCCGGCT GTAGTGCGTC TGGATCAAAA TATGGCTTTT AAATTAAGTT TCGAATTAGT AGATGCTACC  AAAAAGAGTG AAGGTGCCAT ACGCAAAAAG GAAACGACTC ATAAAATGGT AGAGGTAAAG GGCTCTTGCA CATTTTCGTT AATCCAATGA CTATGTACGT AGACAGATGG ATTCGTATAT  ATCGATCGGA AAAGAATCAA TAGAAAGGAG AATGGGACGA TATTTTTCTC GACATCTAAG CTGCAAAGAA TTGATCAACT TTTTTCTAGA GGTAGAATTG ATCAACTAGT GAGCAAACAT  TGCACGGAGA AAATTGATCG TCCCAATCCT AACTCGTGGC ACCGCCGCAG CACTCACCCG GTACCACAGC TATAGCTACA GCCCACAGCC AGAGTCATGT ATGGACGAGG GGCACGCCGA  AAAGTCCAAG TCAATGCTCC CCTTTTCCCG GGCCATCGCC GGCAGTGCCG TCCTATCACA AGGTCGATCC CCGCGGATAT TTTTGACGCA TGCTTTCCAA CAGCGAGCAC CGGGCCGGAG  GCCGGAGGAC CAAAAGGCCC ACATGGCCGC GCCGCACTAA TCGTCGTCGT AATCCCGTAC CTTTGGCCCT TCCGTCCCAC CAGCACCATT GGCTCTGCGC CTCTGCTTTC CCCTTCCAGC  CTGCATCGCG TTGCCTTTGC CCGTGTGGCC GTGTCCCCTT TCTATATAAC CACCGGCAGG GGCCGGCCTT CCCGAGTTTA CTCTATCAAC TACTGGTACG CTGCCACGGC AGAAGAATCT 
CAGGAGCAAC CGCAGCGCTG CCACTGCCCT CTTCTCTCTT CCCCTTCGCG TCCTGCTCTG CTCTCCCCCC TTCGCCACCC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCACCCCCGCGGCGGCGTCTGCCCGCTCCTCTCCCTCGCCGTGTCCCTCGCGCTCCTGTGCGGCGGCGCCGACGCGGCCTTGAGGGAGCTGGAGGTCGGGTACTACGCCCGGACG
TGCCCCGGCGCGGAGGAGATCGTGCGCGGGGTCATGGCCCGCGCGCTCTCACGCGAGCCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GTGAGTACT
TCTCTTCCCCTCCCCCACCTGCCTGCGTCCGCGATCCCCGTCTCGCTCCACGGCTCTGCTTGCTGTTTACTACCACGCCACGGGGTGGTCTCTCATCGATTTCGATCGGCCGCGATTTTC
TCTTGTGGCTCCAGGGATGCGACGGGTCGGTGCTGATGGACGCGACGCCGACGGTGCCGGGGGAGAAGGAGGCGCTGTCCAACATCAACTCCCTCCGCTCGTTCGAGGTCGTCGACCAGG
TCAAGGAGGCGTTGGAGGAGCACTGCCCCGGCGTCGTCTCCTGCGCCGACATCATCGTCATGGCCTCTCGCGACGCCGTCGTCCTG
GTACGAACCCCCTCCCCAGGCTCGCCTCCATCTA
CGCGACGACACGGGGACGATCTGTATGCCCTGTGTTTAATTATTGCATCGGTGAATCTAGCTTACATACGTGCCCTGCCTTATCGTGCGGCAAGATACACGCGAGGGCAATCGGACGACC
AAGCTCTTTTCCTCTTAATATTTGTGAAACCTATAGATTAAAATTAGATTCTAAACTACTCTGCGTACGACACAATTCATACGATTTCTGTGATGTATTGATTTTTGCTTCGCCCAGAGG
CCCAAACCTAGGTGCCTTGAAGTGGTCCTGTTCCTCGCAACAATCAGCAAGCGTTTTTTCACAGTTCAATCAACGGGAGCTGTCCCGTCGAAAGAGTGACGGAAGTCCAAATAATTAGTA
ATGCATTACCTAAATAAATAGACCAAATTACCCTTACAAATGGATGTCTAGATTTGTTTGGTACTCTTGCCTTTTTTTGTCAAAAGGGGGAAGAAACAAAGGGAGAAACTGAAGTTCGAA
ATTGCTTCACTAGTTCTCTATTTTGTCCGTTAATACTTCTGTCTCGCTGTGGGTGGGCCCCGACGGCACCTACCTATGCTCAGCGTCTCTCGCACGCAGAGTCTTCGCATTGCTCTTTTT
CTTCCAGGTTCGTACGCAGAATCGCCGAGACATCTGAGTTCACAGCTGAACTTTTATTTGGGTTGGCACTCTACGCCGTACCAGAAAGTAGAAACAAATGCACAATCGCACGAATCGTTT
AGGAAGTGCTAATTGTTTTCTGAAATCGCGAGGCCAAATGTTCGGAAGAAAATAGGGGGCTATGACAGGGACGGCGCATGTGTGCCTTGCTCCCTCAAACGACCACACGAAACAAGAAGC
GGGCGAGGATGGCGTCACCTCCTCCATCCTTCGCCTGCACATGATTCCCCGTAGGCAGGCAGGTGCATTTAAAGAGGGGGCCTCGCCTACGAAAGGGCCAACAGCCAGAGCTGCAGCCTG
CAGGTATAGTGGCCCTGTACGTATATCATGCCGGCAGCCGTACCCTGCCTTTTGCTGTCAAACTGGTCCTTGACTCCTTTGCCAGCAGGAATAGCAAGGGAAGTAGTAGTAGAGAGTAAA
CGAGATTTTTTTGGTACTTCGTCTGCTTCCTTGTTCCTTTGGGAGCGTGTCGCCGTGCCAGCCATTCGTTTTCTTTTCTCGGCGAGATTCGGGATGGTTCATTGGTGCATGCAAGAGGGG
GGCTAATGCTGTTCTCGGATTATTCGATTATTTCAGTTACGCTTTGAGTTTGTCGTACTTGCTCTCTTGGAATCATAAATGAGCATTACGCTTTGAGTTTGTCGTACTTGCGCTCTCACA
ATGGTCATTAATTTATGCACGAACTGAGTAAATTAAAATAGCCCAGTAAGTGAGACAAGTTTGTTTGACTTCGTTTGACTCTTTACAATCAAACAGTCAAAGGAAAAGGCTTCGTTTGAC
TCTGATTCTCCTTAATTTTCTCTCCCAACAGACCGGCGGACCCCGTTGGGACGTGAGGCTTGGGCGCGAGGACAGCCTGACGGCGAGCCAGGAGGACTCGGACAACATCATGCCGAGCCC
GCGCGCCAACGCGAGCACCCTCATCCGCCTCTTTGCCGGCTACAACCTCACCATCACCGACCTCGTCGCGCTCTCTGGCTCACACTCCATCGGTCAGGCCCGCTGCTTCTCCATCGTCTT
CCGCCTATACAACCAGTCGGGCTCCGGTCGGCCTGACCCCCACATGGACCCAGCCTACCGCGCCAAGCTCGACGCGCTTTGCCCCCTGGGCGGCGATGAGGAAGTCACCGGCGGCATGGA
CGCCACCCCGATCGTCTTCGACAACCAGTACTTCAAGGACCTCGTCCACCTCCGGGGGTTCTTGAACTCAGACCAGACGCTCTTCTCTGACAACGCCGGTACTCGCCAGGTGGTGGCAAA
GTTCAGCGAGGATCAGGACGCCTTCTTCAGGGCCTTCGCTGATGGCATGGTCAAGATGGGAGAGCTCCAGAACCCAAGGAAGGGGGAGATACGACGCAACTGCCGCGTCGCCAACGGCTC
ACCATCTCCGAGGCACAAGCAGGTCCTGCTCGTGCAGTCCCTGGTGCAGGACTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCACCCCCGCGGCGGCGTCTGCCCGCTCCTCTCCCTCGCCGTGTCCCTCGCGCTCCTGTGCGGCGGCGCCGACGCGGCCTTGAGGGAGCTGGAGGTCGGGTACTACGCCCGGACG
TGCCCCGGCGCGGAGGAGATCGTGCGCGGGGTCATGGCCCGCGCGCTCTCACGCGAGCCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GGATGCGAC
GGGTCGGTGCTGATGGACGCGACGCCGACGGTGCCGGGGGAGAAGGAGGCGCTGTCCAACATCAACTCCCTCCGCTCGTTCGAGGTCGTCGACCAGGTCAAGGAGGCGTTGGAGGAGCAC
TGCCCCGGCGTCGTCTCCTGCGCCGACATCATCGTCATGGCCTCTCGCGACGCCGTCGTCCTG
ACCGGCGGACCCCGTTGGGACGTGAGGCTTGGGCGCGAGGACAGCCTGACGGCGAGC
CAGGAGGACTCGGACAACATCATGCCGAGCCCGCGCGCCAACGCGAGCACCCTCATCCGCCTCTTTGCCGGCTACAACCTCACCATCACCGACCTCGTCGCGCTCTCTGGCTCACACTCC
ATCGGTCAGGCCCGCTGCTTCTCCATCGTCTTCCGCCTATACAACCAGTCGGGCTCCGGTCGGCCTGACCCCCACATGGACCCAGCCTACCGCGCCAAGCTCGACGCGCTTTGCCCCCTG
GGCGGCGATGAGGAAGTCACCGGCGGCATGGACGCCACCCCGATCGTCTTCGACAACCAGTACTTCAAGGACCTCGTCCACCTCCGGGGGTTCTTGAACTCAGACCAGACGCTCTTCTCT
GACAACGCCGGTACTCGCCAGGTGGTGGCAAAGTTCAGCGAGGATCAGGACGCCTTCTTCAGGGCCTTCGCTGATGGCATGGTCAAGATGGGAGAGCTCCAGAACCCAAGGAAGGGGGAG
ATACGACGCAACTGCCGCGTCGCCAACGGCTCACCATCTCCGAGGCACAAGCAGGTCCTGCTCGTGCAGTCCCTGGTGCAGGACTACTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCACC CCCGCGGCGG CGTCTGCCCG CTCCTCTCCC TCGCCGTGTC CCTCGCGCTC CTGTGCGGCG GCGCCGACGC GGCCTTGAGG GAGCTGGAGG TCGGGTACTA CGCCCGGACG  TGCCCCGGCG CGGAGGAGAT CGTGCGCGGG GTCATGGCCC GCGCGCTCTC ACGCGAGCCC CGCAGCGTCG CCTCCGTCAT GCGCCTCCAG TTCCACGACT GCTTCGTCAA CGGATGCGAC  GGGTCGGTGC TGATGGACGC GACGCCGACG GTGCCGGGGG AGAAGGAGGC GCTGTCCAAC ATCAACTCCC TCCGCTCGTT CGAGGTCGTC GACCAGGTCA AGGAGGCGTT GGAGGAGCAC  TGCCCCGGCG TCGTCTCCTG CGCCGACATC ATCGTCATGG CCTCTCGCGA CGCCGTCGTC CTGACCGGCG GACCCCGTTG GGACGTGAGG CTTGGGCGCG AGGACAGCCT GACGGCGAGC  CAGGAGGACT CGGACAACAT CATGCCGAGC CCGCGCGCCA ACGCGAGCAC CCTCATCCGC CTCTTTGCCG GCTACAACCT CACCATCACC GACCTCGTCG CGCTCTCTGG CTCACACTCC  ATCGGTCAGG CCCGCTGCTT CTCCATCGTC TTCCGCCTAT ACAACCAGTC GGGCTCCGGT CGGCCTGACC CCCACATGGA CCCAGCCTAC CGCGCCAAGC TCGACGCGCT TTGCCCCCTG  GGCGGCGATG AGGAAGTCAC CGGCGGCATG GACGCCACCC CGATCGTCTT CGACAACCAG TACTTCAAGG ACCTCGTCCA CCTCCGGGGG TTCTTGAACT CAGACCAGAC GCTCTTCTCT  GACAACGCCG GTACTCGCCA GGTGGTGGCA AAGTTCAGCG AGGATCAGGA CGCCTTCTTC AGGGCCTTCG CTGATGGCAT GGTCAAGATG GGAGAGCTCC AGAACCCAAG GAAGGGGGAG  ATACGACGCA ACTGCCGCGT CGCCAACGGC TCACCATCTC CGAGGCACAA GCAGGTCCTG CTCGTGCAGT CCCTGGTGCA GGACTACTAA TCCACGGGAG GTCTGTATCC TGTAGATGTC  TCCTGATAGC TGTGATGTGA AACTGAAAAT GACGGATGTG TTTGACATAG TTTTGGTTGT CTCGCAGTTC TGTGCCAACC TAAGAATGGT TTCAGATTTT GCTAACTGTT GTCTGTTGAG  GATAATAGGT GTCTCCGATC ATTAGTTGAC CAGTCATAGC AAGCTTGCTT CGGGATCAGA TACTGGGGTT TGAGTTCGAC TAAAGCTGTC AGGCCAGGTA GGTTTTGAGG AACATTGGGG 
TTTTCCTTTT GCTGTGACTG AGGATATGTC TATTGTGCCC GGTGAAAAAA AAAATTCAAG GA 

Retrieve as FASTA