Entry information : BdiAPx07 (Bradi5g10490)
Entry ID 7896
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-01-19 (Toky Ramarohetra (Scipio))
Peroxidase information: BdiAPx07 (Bradi5g10490)
Name (synonym) BdiAPx07 (Bradi5g10490)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiAPx07
start..stop
S start..stop
HvAPx06 606 0 1..345 1..348
TaAPx02 592 0 1..345 1..348
OsAPx07 546 0 18..344 25..358
SiAPx05 535 0 33..345 32..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13768006..13768170 165 N° 2 13767796..13767924 129 N° 3 13764840..13764960 121 N° 4 13764649..13764749 101
N° 5 13764461..13764548 88 N° 6 13764092..13764159 68 N° 7 13763923..13764009 87 N° 8 13763445..13763519 75
N° 9 13763285..13763362 78 N° 10 13763089..13763193 105 N° 11 13762867..13762887 21  
complement(join(13762867..13762887,13763089..13763193,13763285..13763362,1376344 5..13763519,13763923..13764009,13764092..13764159,13764461..13764548,13764649..1 3764749,13764840..13764960,13767796..13767924,13768006..13768170))


exon

Literature and cross-references BdiAPx07 (Bradi5g10490)
DNA ref. Phytozome 11:   Bd5 (13768170..13762867)
EST ref. GenBank:   GT766713.1 [3' end]
Protein sequence: BdiAPx07 (Bradi5g10490)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   345
PWM (Da):   %s   37327  
PI (pH):   %s   9.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERLAAAAALRTSAPYHPSPSGRRAGPSNSAFFPSSSSPSPALRRVSLRAAPSQKAKAAGRGRSLRCMAAASDAAQLKAAREDTRELLKTTHCHPILVRLGWHDSGTYDKNIEEWPQRGGANGSLRFDVELKHGANAGLINALKLIQPIKDKYPSITYADLFQLASATAIEAGGPKLPMRYGRVDVTGPEQCPPEGKLPDAGPSAPADHLRVVFYRMGLDDEIVALSGAHTLGRSRPERSGWGKPETRYTKNGPGAPGGQSWTAEWLKFDNSYFKEIKEKRDQDLLVLPTDAALFEDPAFKVYAEKYAEDQVAFFKDYAEAHAKLSSLGAKFDPAEGFSLDD*

Retrieve as FASTA  
Remarks Complete sequence fom genomic (chromo 5, 10 introns), 6 ESTs. Strain="Bd21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGCGCCTAGCTGCAGCCGCCGCCCTCCGTACTTCCGCTCCGTACCATCCCTCCCCGTCCGGCCGCCGCGCCGGGCCATCCAACTCCGCCTTCTTCCCGTCCTCATCCTCGCCT
TCGCCGGCTCTCCGCCGCGTCAGCCTCCGCGCCGCGCCCTCCCAG
GTCAGGTTCGGGGCGGTTCAGGATGTCAACCTCAGTGTTCTGGTTGTTGAGTTGTGCTTGGTTATACTTGTGTGA
TCGCAGAAGGCCAAGGCGGCGGGGAGGGGGCGATCTTTGAGGTGCATGGCGGCGGCGTCGGACGCGGCGCAGCTGAAGGCCGCGCGCGAGGACACCAGGGAGCTCCTCAAGACAACCCAC
TGCCATCCCATCCTG
GTACGTTTAGTACCGTAGACTGACACGCTATGCCACGCGCTTAGGATACCAAGAAATTTTTCCTTGAATCACCATCTTGTAGGACAGCGAGTTGAATTTAATCTT
AGAGCAATGTGGGGATTTAACATCGTAAAGTGCTTTGTTAGACAGCTTGCTTATCTCAAAAGGGCTTGTCAGTTGTGTAACCTCTAGATCCAATTGCAGCATCGATCATTTACAGTGACA
AAGGCTGGCAGCAGCTTTTCTGAATTCGACTGTCAAGTGCCAACTGCCAAATGATCTGCTCGTACTTAAGTCAGGCTTCAGTGGTCACTTGTACATCTCGTTCCATTTTCTCACTATGGA
GCTTAAAATGCTTCTATTTGTGATGCATGGAGCTTATCCCTTATATACAGACAGAATTTTGATTATACATGAGATATTCGACTATTCGTTCCGTTCCAAAATATAAGGCACATAAATATA
GGTGTGGTCAACATTCTAAAATTTGAATAATAATATATGCGAAGTTATATGGATTGGACATGTAACAATAATATCATATTTGTCTTGTAAAATATTTTTATGCTGTATGCCCTTTAATAA
TTTTGTAGGCATATTATAAGCCAAAATCATTCTCAAAATTGTGCATTGAGTATCTGTGAAAAATAAAGCATGTCTTGTATTTTGCACAGAGAGTGTTTGTTTTGTCATCTGTATTGTATG
AAGTATGTAAATAAAATTGACCAATAAGAATATTAGATGATCTTGGTTGCTTAGCCATCAAATCTGGCGACATGAATGTTGTTGTAGTAAAATAAAACCCTTGTATGGGCCGGGCCATAA
ATCCTACGTGGCGACGACTAGGTCAGCATTTTCCTACATGGGTCAAGATGCCAACATGGCGTGGTCAATCCTATATGGCAATGGTCAAGACAAGTCAACAAGTCAAGCCTCTCATGTCAT
GGTCAAATGGTGGAATGAGCTTTTTCCAAGTCAACCCCTACTTTTCCCACTTGGTGCACATAAAAGCTATGGACCAAGGAGCTACTTTTACCACTTTGCCCCCACTTTTCTCTCTCCCTC
AAGGGTAGCCATGGTCTTTTGTCATGGACCCCTAAGCTATAAATACCCCCCCATGGGGGCATGTACCATTCACTCTCAACTTGAATAAACTCAAGGGGAGAGGGCTAGAGTGCTCCCTCT
AAGGTTTGCTTTCGAGCTCCGCTTTCGACTAAAAGTCAACCGGCCTCGAGGAAGCCTTCTAGGGGACTCTAGTTTCGAGGCTCCGCGCTAAACTCGGTTAGCGCGGGCTCGAAGGAGAAG
GGGTTGGGTTAGAGTTCCGAGGGTATCCTAACCTCGATACTTGGAAAGACGCGTTCGGTCCAAGTACGAGGCGGCCCTGACGAATCTCTCGCTAAAGGTGTCGTGGGAAGATCCGCTCGG
CCCAAGCACTTGGCTAACAACCCCTCGAATCCTTTCCTAACATAGGACTAAGTCGTACCCGCAGGGTCGACTGAACCTATTCAAAAAATATCGACATGTCAACTTGTCCAAGTGTACGGC
GACCTTCGCTATAAGGCCGGCGTACACACCCTACTTTCATACACGCACTTGTGCCATCGAGCATTGGCACCCCTTACTCTAATTGTTGTCAAGAACAACAACAAATGTTATGTCACTAAT
GATACTTGACAAATGAAGAGCACTATCAAATGACTCTTTAGGCAGGGATGAAGCCAGGAAAAATATCCACTGGGTTCAGCCACTAAGGGAATATTTTAGTGAGCTAATTGTAATAGTGGT
GTAACCTTGCACCAAGTTGTCATAAAATTAGCAGAACAAAAACTTATAAGACATTATTAAAAAATTATGAAATGATATAATTGTTGTTACATTCAAAAACAAGACATACTGATTGCTGAT
TTGGCGAAGTCATAAAATCACTTACTTACATATTTCTAACAAAGTAAGAAGATGATTTCCCAGCTTTCGTAGCTTCCCGGAAAGAATGAGCTAAAAGAACGTAGTATTATATTCACAGTA
GTAGTAGGAACAAAATATTACACTAAATACGTTAAGTGAAACATGAAAGGTCCCTCACACTTTAAAATTCCCCTTCTTGATTTATCTTCCTAAAGAGAGAAATCAGGCGTACATGAGCCA
CCAATTGGCTACTGAGTTGCCGCATCGTATGTTGTGGGTGGCAGGTCCTTGGCGGGTTGGTTGTTGACTGGTCGCCAGTTCGTGTGACTAGCCTTAAGGCTGTACTTAAGCTTAGAGCCT
GGGACTTTGGTCTTCTGCACCTGGGCTCGGATAATCTGTTTTTTTTTGGTTGTATTCAATCATTCAATGACATATTACATATATACTCCCTGTCCTAGTTGAAACGCTGGGTAGCATTGG
TGTCACGTGACACCAGCGCTAAGCTAGCTCCGTCCCTGTCCTTAACTGGAAGTCTGCTTTCAATCACTGCATGCTACATTTTCTTTTATTTTACCTTTGTGTGGTCATGGGAAGTTTATC
CTTGTCGGTAACTATCTTGGATATTTTTGCCCCGTTGGTAGTCATAGAAGCTTATGGCATCGATAGGACTGCTATCTGTTCAAATAAGCACTCTTCATCGAGATTTTCAAAAAGAAATAG
AGAAAAGAAAAATGAGAAGTGAAACTTTTCATATCATGTTGAAGCTGGGATGATATGTGTCCCTTTCTAAAAGCAAATCATTTTGCAATATGCAATGACATAGACCTTATGCTTTTGTTT
TATTATTCGAATACATACCGATGTATGCAAGATCTTAATTTGTTTTCTTTATCGAAGATTATTAATTGTTATATGTTTGACTGCATGAAGGTTCGTCTGGGATGGCACGATTCTGGCACA
TATGACAAGAATATTGAGGAGTGGCCACAACGTGGTGGGGCTAATGGAAGCTTAAGATTTGATGTTGAGTTGAAACATGGAGCCAATGCAG
GTACAGTTACTTGGATTTTCACCATTCTA
TTTCTTTGTTCCCCCTATGTGTACAGGTAATAACTAAAATCCCTGATTGGTATCCTTAAAGGTTTGATAAATGCTCTAAAGCTTATTCAACCGATCAAGGACAAATATCCGAGTATCACT
TACGCAGATTTATTCCAGTTGGCAAGTGCTACAGCAATTGAG
GTCTGACCTTCCCCCCATTGAAGTATCTGGCTATGTTAGTTTTAATAAATAAGGACTGTACTCAAACCTAATGATCTT
TCTTTTGTCAATCTCGTACCAGGAAGCTGGTGGCCCAAAGCTTCCAATGAGATATGGACGGGTTGATGTCACAGGACCTGAGCAGTGTCCACCTGAGGGCAAGCTTCCTGGTTAGCACTG
TTCACCAACCATTCTAGTTTCTTGTCTTCTGTACCAATATCCTTCTCAGTCTTTTTTGTGTCTGCAAAAATGTTCTAAAGATACGAAGCATCTCTCGAGTCCTGACTGCTTGAAATATGA
ACTAAGTGTATATCTGTTATTTCCACAGTTTTACTGAATAATTATTGCCACATTGATAGCACTGGATATGTGCTTAAGAATTTATAGACAAAAATGCACCGGCTTGTTGCTAAAATCATT
TAATCTGATGCTTGGTGACTCTTGAATGAACTGTTCGGTTGGGTTTTTCAGATGCTGGCCCAAGTGCACCTGCTGACCACTTGAGGGTGGTATTCTACAGAATGGGCCTTGATGACAAGG
TGCACAAATAATTATCTGAGTTACCTGTTTGCCCATGTTCTTTTAACTGGCTTTGTTGAGCTGTGTACCCTGTGTCTGCAGGAAATTGTTGCATTGTCTGGCGCACATACACTTGGAAGG
TCTAGGCCTGAACGGAGTGGCTGGGGGAAACCTGAAACGAGATATACT
GTACGTTTATCTTAACATCTCTGTGCATATATGCCATGTTGGATGTTTTGATTTCGATGTTCAGGTTAATAA
TTGGGTAGCATGTTACAGTATCATTTTGAGCACATGTGCTTTATCAATATTTCTGCTTAAAATTACCCTTAATCTCTCTGGGAACGCTGTGCTTGCTTTCAAGATCTGGACATGCCGGCG
TACAGTTGAGCCTGTCATGCTTAACATATTGTTTATTAGCCTTTATTCATGTCGGATGGTGTCAGTTGATGCATGCAAATTTTAGCCCCCACCATATTTACAATACGTCTTCAAAACATC
GATGCTACATGCACTGCTCCATGAAGCTAGATGCACATGACTATTGGCTGCATGAGTGAAGTTCTTGAATATGTTTTTATCACTTGGACAGAAAAATGGTCCTGGTGCCCCTGGTGGTCA
ATCATGGACAGCTGAATGGCTGAAGTTTGATAACAGTTACTTCAAG
GTAAGTGACCCATTTTCCATATTGTACATGCGTGGGCAATTCATCTGATTTTGGGAGATCTGAACTGGTAGCAA
TACTTTAGGAGATAAAAGAGAAGAGAGATCAGGACCTTCTGGTCTTGCCTACAGATGCTGCATTATTTGAGGACCCAGCATTCAAGGTGATTCTGATGCTAAATCTGCATGTTCTCAGTA
TCCTATGAAAATGAAATAACTATTAAACTTACTACCTGAGAATGACAACACTTTCAGGTCTATGCAGAGAAATATGCGGAGGACCAAGTAGCATTCTTTAAGGACTACGCCGAAGCTCAT
GCTAAACTGAGCAGCCTGGGTGCAAAGTTTGATCCTGCTGAG
GTCAGTGCAGCATTTCGTTCATAGTTTTCCGACAGCTGGTCACCTTTTTAGTCTTAGTTTAGACAGATAGCACATTCA
CTTGTGTAGCTGGTAAGTCTGGTAACAGCTCGTTCTGACAAACCGTTGCAGATGTTGCTCTGCTGAGTTGTGCCAACCTTATCGTCCTTGTGTTTCATACTGATCTATGTGGTTATCCTG
CAGGGATTCTCATTGGATGATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGCGCCTAGCTGCAGCCGCCGCCCTCCGTACTTCCGCTCCGTACCATCCCTCCCCGTCCGGCCGCCGCGCCGGGCCATCCAACTCCGCCTTCTTCCCGTCCTCATCCTCGCCT
TCGCCGGCTCTCCGCCGCGTCAGCCTCCGCGCCGCGCCCTCCCAG
AAGGCCAAGGCGGCGGGGAGGGGGCGATCTTTGAGGTGCATGGCGGCGGCGTCGGACGCGGCGCAGCTGAAGGCC
GCGCGCGAGGACACCAGGGAGCTCCTCAAGACAACCCACTGCCATCCCATCCTG
GTTCGTCTGGGATGGCACGATTCTGGCACATATGACAAGAATATTGAGGAGTGGCCACAACGTGGT
GGGGCTAATGGAAGCTTAAGATTTGATGTTGAGTTGAAACATGGAGCCAATGCAG
GTTTGATAAATGCTCTAAAGCTTATTCAACCGATCAAGGACAAATATCCGAGTATCACTTACGCA
GATTTATTCCAGTTGGCAAGTGCTACAGCAATTGAG
GAAGCTGGTGGCCCAAAGCTTCCAATGAGATATGGACGGGTTGATGTCACAGGACCTGAGCAGTGTCCACCTGAGGGCAAGCTT
CCTG
ATGCTGGCCCAAGTGCACCTGCTGACCACTTGAGGGTGGTATTCTACAGAATGGGCCTTGATGACAAGGAAATTGTTGCATTGTCTGGCGCACATACACTTGGAAGGTCTAGGCCT
GAACGGAGTGGCTGGGGGAAACCTGAAACGAGATATACT
AAAAATGGTCCTGGTGCCCCTGGTGGTCAATCATGGACAGCTGAATGGCTGAAGTTTGATAACAGTTACTTCAAGGAGATA
AAAGAGAAGAGAGATCAGGACCTTCTGGTCTTGCCTACAGATGCTGCATTATTTGAGGACCCAGCATTCAAG
GTCTATGCAGAGAAATATGCGGAGGACCAAGTAGCATTCTTTAAGGAC
TACGCCGAAGCTCATGCTAAACTGAGCAGCCTGGGTGCAAAGTTTGATCCTGCTGAG
GGATTCTCATTGGATGATTAG

Retrieve as FASTA