Entry information : BdiPrx133 (Bradi5g24200)
Entry ID 7898
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx133 (Bradi5g24200)
Name (synonym) BdiPrx133 (Bradi5g24200)
Class Class III peroxidase    [Orthogroup: Prx154]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx133
start..stop
S start..stop
SbPrx95 515 0 1..323 1..321
SiPrx55 514 0 25..323 21..320
OsPrx57 513 0 1..323 1..319
ZmPrx91 511 0 4..323 3..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25916815..25917036 222 N° 2 25917131..25917313 183 N° 3 25917418..25917984 567  
join(25916815..25917036,25917131..25917313,25917418..25917984)


exon

Literature and cross-references BdiPrx133 (Bradi5g24200)
DNA ref. Phytozome 12:   Bd5 (25916815..25917984)
Protein sequence: BdiPrx133 (Bradi5g24200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (296)
PWM (Da):   %s   33856.76 (31189.3)  
PI (pH):   %s   5.18 (4.89) Peptide Signal:   %s   cut: 28 range:28-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPSKHTFGTCGITALLLLLSAALVSAKLSTEFYDETCPDALDIIEDAVRAAVSKESRMGASLLRLHFHDCFVNGCDGSVLLDGANGEKNAVPNKNSLRGFELIDNIKAELEDSCAKVVSCADILAVAARDSVVALGGPTWEVELGRRDGTTSSLDAANNDLPAPSSDLGALIKAFSDKGLTAKDMVALSGAHTIGQARCVNFRDRLYNENATLDATLASSLKPRCPSTASNGDDNTSPLDPSTSYVFDNFYYKNLMKKKGLLHSDQQLFNGGSADAQTTGYASATGMAGFFDDFRVAMVKMGGIGVVTGAGGQVRVNCRKAN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, intron 1 & 2), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCATCCAAGCACACCTTCGGTACCTGCGGCATCACGGCCTTGCTCCTCCTCCTCTCTGCCGCTCTCGTCTCGGCTAAGCTCTCCACCGAATTCTACGACGAGACCTGCCCCGAC
GCCCTGGACATCATCGAGGACGCCGTGAGAGCCGCCGTCTCCAAAGAGTCCCGCATGGGGGCCTCGCTGCTCCGCCTCCATTTCCACGACTGCTTTGTCAAT
GCAAGTGTCATACATATG
CTTACCACCTTCCTAAATCCTAACTTAAGTCTTAAGCTCTCCCTTTTCAAGGACTAACCATTGAGCATCTTTACAGGGCTGTGACGGGTCAGTGCTGCTGGACGGCGCCAACGGCGAGAA
GAACGCGGTGCCAAACAAGAACTCCCTCCGTGGGTTCGAGCTGATCGACAACATCAAGGCGGAGCTCGAGGACTCCTGCGCCAAGGTCGTCTCCTGCGCCGACATCCTCGCCGTCGCCGC
CCGCGACTCCGTCGTCGCC
GTAAGCCAAGCTTCCGCTAAGAACTCAAAACCACTTCCTGACATCCATGTACACGAAATCGGAGGCAGCAGCTAACACGTGAGTTTATTGTTTTTTAACTG
CAGCTGGGCGGGCCAACGTGGGAGGTGGAGCTAGGCCGAAGGGACGGGACAACCTCAAGCCTAGACGCCGCGAACAACGACCTCCCGGCACCATCCTCCGACCTCGGCGCCCTCATCAAG
GCATTCTCCGACAAAGGCCTGACCGCAAAAGACATGGTGGCGCTGTCCGGCGCGCACACGATCGGGCAAGCCCGGTGCGTCAACTTCAGGGACCGGCTCTACAACGAGAACGCCACCCTG
GACGCCACGCTGGCCTCGTCGCTGAAGCCGAGGTGCCCGTCGACGGCGAGCAACGGCGACGACAACACCTCGCCGCTCGACCCCTCCACGTCATACGTCTTCGACAACTTTTATTACAAG
AATCTGATGAAGAAGAAGGGCCTGCTGCACTCGGACCAGCAGCTGTTTAATGGCGGGTCGGCCGACGCGCAGACCACGGGGTACGCGTCGGCGACCGGCATGGCGGGGTTCTTTGATGAT
TTCCGTGTCGCCATGGTGAAGATGGGCGGCATTGGGGTGGTCACTGGGGCTGGGGGGCAGGTCAGGGTTAACTGCAGGAAGGCCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCATCCAAGCACACCTTCGGTACCTGCGGCATCACGGCCTTGCTCCTCCTCCTCTCTGCCGCTCTCGTCTCGGCTAAGCTCTCCACCGAATTCTACGACGAGACCTGCCCCGAC
GCCCTGGACATCATCGAGGACGCCGTGAGAGCCGCCGTCTCCAAAGAGTCCCGCATGGGGGCCTCGCTGCTCCGCCTCCATTTCCACGACTGCTTTGTCAAT
GGCTGTGACGGGTCAGTG
CTGCTGGACGGCGCCAACGGCGAGAAGAACGCGGTGCCAAACAAGAACTCCCTCCGTGGGTTCGAGCTGATCGACAACATCAAGGCGGAGCTCGAGGACTCCTGCGCCAAGGTCGTCTCC
TGCGCCGACATCCTCGCCGTCGCCGCCCGCGACTCCGTCGTCGCC
CTGGGCGGGCCAACGTGGGAGGTGGAGCTAGGCCGAAGGGACGGGACAACCTCAAGCCTAGACGCCGCGAACAAC
GACCTCCCGGCACCATCCTCCGACCTCGGCGCCCTCATCAAGGCATTCTCCGACAAAGGCCTGACCGCAAAAGACATGGTGGCGCTGTCCGGCGCGCACACGATCGGGCAAGCCCGGTGC
GTCAACTTCAGGGACCGGCTCTACAACGAGAACGCCACCCTGGACGCCACGCTGGCCTCGTCGCTGAAGCCGAGGTGCCCGTCGACGGCGAGCAACGGCGACGACAACACCTCGCCGCTC
GACCCCTCCACGTCATACGTCTTCGACAACTTTTATTACAAGAATCTGATGAAGAAGAAGGGCCTGCTGCACTCGGACCAGCAGCTGTTTAATGGCGGGTCGGCCGACGCGCAGACCACG
GGGTACGCGTCGGCGACCGGCATGGCGGGGTTCTTTGATGATTTCCGTGTCGCCATGGTGAAGATGGGCGGCATTGGGGTGGTCACTGGGGCTGGGGGGCAGGTCAGGGTTAACTGCAGG
AAGGCCAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCATGCACTC CTAGTCTAGT CTACTAGTCC AAGCCTACAC ACAGTACACA CTGAAGTCTG AAGTTAGCTG CACTTGCCTA GCTCAGTTAA GCTATCAGCA ACCAATGGCG CCATCCAAGC  ACACCTTCGG TACCTGCGGC ATCACGGCCT TGCTCCTCCT CCTCTCTGCC GCTCTCGTCT CGGCTAAGCT CTCCACCGAA TTCTACGACG AGACCTGCCC CGACGCCCTG GACATCATCG  AGGACGCCGT GAGAGCCGCC GTCTCCAAAG AGTCCCGCAT GGGGGCCTCG CTGCTCCGCC TCCATTTCCA CGACTGCTTT GTCAATGGCT GTGACGGGTC AGTGCTGCTG GACGGCGCCA  ACGGCGAGAA GAACGCGGTG CCAAACAAGA ACTCCCTCCG TGGGTTCGAG CTGATCGACA ACATCAAGGC GGAGCTCGAG GACTCCTGCG CCAAGGTCGT CTCCTGCGCC GACATCCTCG  CCGTCGCCGC CCGCGACTCC GTCGTCGCCC TGGGCGGGCC AACGTGGGAG GTGGAGCTAG GCCGAAGGGA CGGGACAACC TCAAGCCTAG ACGCCGCGAA CAACGACCTC CCGGCACCAT  CCTCCGACCT CGGCGCCCTC ATCAAGGCAT TCTCCGACAA AGGCCTGACC GCAAAAGACA TGGTGGCGCT GTCCGGCGCG CACACGATCG GGCAAGCCCG GTGCGTCAAC TTCAGGGACC  GGCTCTACAA CGAGAACGCC ACCCTGGACG CCACGCTGGC CTCGTCGCTG AAGCCGAGGT GCCCGTCGAC GGCGAGCAAC GGCGACGACA ACACCTCGCC GCTCGACCCC TCCACGTCAT  ACGTCTTCGA CAACTTTTAT TACAAGAATC TGATGAAGAA GAAGGGCCTG CTGCACTCGG ACCAGCAGCT GTTTAATGGC GGGTCGGCCG ACGCGCAGAC CACGGGGTAC GCGTCGGCGA  CCGGCATGGC GGGGTTCTTT GATGATTTCC GTGTCGCCAT GGTGAAGATG GGCGGCATTG GGGTGGTCAC TGGGGCTGGG GGGCAGGTCA GGGTTAACTG CAGGAAGGCC AACTGAAGTA  AGTAACTGGC TGTCAGTGTG GTGTCAGGCT TCTCTCAACT CAGGGTCTCT GTGCTGTGAG TCTCTGCGTG TGTGTTGTGT TTGTGATTTG CGGGTACAAT TTCTTCTTGT GTGATGGTGT 
AGAGTCTGCT TCGAACGGTT GTAGACTTGT ACTACTATAC GAAGACAAAT TCGAGGAATA ATGAGTAAGA TTGGATAAAT TACCTGTTTG 

Retrieve as FASTA