Entry information : BdiPrx134 (Bradi5g24650)
Entry ID 7899
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx134 (Bradi5g24650)
Name (synonym) BdiPrx134 (Bradi5g24650)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx134
start..stop
S start..stop
SbPrx96 592 0 25..342 20..337
OsPrx58 590 0 26..342 19..337
ZmPrx04 586 0 40..342 30..332
HvPrx23 585 0 26..342 10..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 26212564..26212821 258 N° 2 26212921..26213118 198 N° 3 26214199..26214364 166 N° 4 26215649..26216055 407
join(26212564..26212821,26212921..26213118,26214199..26214364,26215649..26216055 )


exon

Literature and cross-references BdiPrx134 (Bradi5g24650)
DNA ref. Phytozome 12:   Bd5 (26212564..26216055)
Protein sequence: BdiPrx134 (Bradi5g24650)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   342
PWM (Da):   %s   36550.49  
PI (pH):   %s   9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGGSSSSCSCEKKKLLLMWWRAGVLLAAVTLAGVVDAQQLRQNYYGSSCPSAESTVRSVISQHVQQSFAVAPGTLRLFFHDCFVRGCDASVMLMAPNGDDESHSGADATLSPDAVDAINKAKAAVEALPGCAGKVSCADILAMAARDVVSLTGGPSYNVELGRLDGKTFNRAIVKHVLPGPGFDLNQLNALFASNGLTQFDMIALSGAHTIGVTHCDKFVRRIYTFKQRLAYNPPMNLEFLRSLRRVCPINFSPTSFAMLDATTPRAFDNAYFNNLRYNKGLLASDQVLFTDRRSRPTVNLFAANATAFNEAFVAAMAKLGRIGIKTGAGGEVRRVCTAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGGGGAAGTAGTAGTAGCTGCAGCTGCGAGAAGAAGAAGCTCCTCCTGATGTGGTGGAGAGCGGGTGTCCTATTGGCTGCCGTGACACTGGCGGGCGTGGTGGACGCGCAGCAG
CTGCGGCAGAACTACTACGGCAGCAGCTGCCCGAGCGCCGAGTCGACGGTCCGGTCCGTGATCTCGCAGCACGTGCAGCAGAGCTTCGCCGTCGCGCCCGGCACGCTCCGCCTCTTCTTC
CACGACTGCTTCGTCCGG
GTAAGCACACAGCACACACAGCAAACTGCTCCGTTTTTTGGCCAGAGAGGGATGTTACTACGGCACATTTTGATTTGATTTGGCATTGTGGATTTGCAGGGT
TGTGACGCGTCGGTGATGCTGATGGCGCCCAACGGGGACGATGAGAGCCACAGCGGCGCCGACGCGACGCTGTCGCCGGACGCCGTGGACGCCATCAACAAGGCCAAGGCGGCCGTCGAG
GCGCTCCCGGGATGCGCCGGCAAGGTCTCCTGCGCCGACATCCTCGCCATGGCCGCGCGCGACGTCGTCTCCCTG
GTATGGTAGCCATTGATTCCTTCGCCCTCTAGCTAGCTTACGCAC
GACGACTTCATTCAACGTATTGGTATCGTACCGTGCTGTGTTATCCCGTCACGCCCGGCGGTTTCCCGTGGGGCGGGCGGGCGGGCGCACGCGGCCCTTGTCAGACGCCACGGACCCCCC
GGCCCCACAGCTGGGAAATGAAATGGCTGGCTTCCTCTTGTCCGTGCCAGCGTTGTGAACCGCTTTGGCAGGAGGAAGAGCCCACCACGGTTGACGGGGGCGGTCGGTCTGTCTGACGGC
AGGCGGCCGGTAAGCCGGGGTACGTACACTGTTCGACCAGCTTGCCCGTCAGTGACTTTCAAGCTAGCCATCAGATTTGAGCCCCCCTTCCCATGGTCCAACTATCACAGCATTGCGATC
CATCCACGCCCGGAGATCGAATCGACCCATATGCACGCATATCTCTAGAGTCTCCCGGTCCCTCCCTTCCCGTAGCGCAAAAAAGGAGCTCACGATGCCAAAGGACACGTGACTCGTGTC
GCCCGGATCGATGCCGATGCACGGGAAGAGCCCCTACGAGCTCTTCTGCTCGCGCCGGGGCCGGGCTAGCTGCCCCGGTGGCCGTGATCCCGGCGAAGGCCTCTCTAATCTCCGCCTATT
CTTTCTCTCGTCTTTTGAGGAGACGGCAACGGCCTCGGGCGTGTCGTACGTTTTTCTTTCTGCGACAGTGACGTGAGAGGAGATGAGATGAGAACTGGAACGCTGCGTTTGTACATGCTG
CCCGTGACGGACGCTTTGCCCTTAGCTTTGGGCCGGATACGATGCAGACAGAGGGTCCGTGACCGTGAGGCTGCCTTCCTGCAAGGCGTGTTCTCGTCCGCGAAGCTCAGCTGGCGGACA
AAATTTCCTTTCCGTAGACTCTCGTAGCAGACTCCGCCACTGCTTGCGTGCGTGGATGACGAGGTGTATGTACGGACAAACTAGCTCACGAAACTTGTTTTTTTCAGTCCCAGCTAAGCT
ACTAGAGGAAGTCGCATTTACCATGATTTCGTTCGTGTTGACATTTTCTGTTCTGTTTTGTTTGCTTGTTTGTAGACTGGCGGGCCGAGCTACAACGTGGAGCTGGGGCGGCTGGACGGG
AAAACGTTCAACAGGGCCATCGTGAAGCACGTCCTCCCGGGCCCCGGCTTCGACCTCAACCAGCTCAACGCGCTCTTCGCCAGCAACGGGCTCACGCAGTTCGACATGATCGCGCTCTCC
G
GTAATAAACCTCATGTTTTCTTCTTCTGAAAAGGCATAAGGAGTATCAGTTAGCGGTTCCTCGATCGTAACCTCGATTTTAGCTTTGCGCTTGTTTTAAAAAAAAGCCATTACCTTTTC
CGTCCGTGGCCTGTCTGGTCTCTAGCTAGCTGCACAGTTCACGTGACGTATGTACGTATCCTAGCACAAGGACAAAGAGGTTCAGCGTTTTTATACACTGGAGTACTCTGTTCATTTCGA
TGACAGTTTTTTTTTTTGTTCTGGAGCCGGAAGATGGCAGATTTTAAAATAAGCTCGGCTTCGTTGTGTGTGCATCGAAAGTAGAAACCCACTTTGCGGGGACAGAAAAATCCACATTTA
GACGTGAAAACCCGACACAAAGTGTTTAAAATAGGAGCGATTTCTGTGCAAGGCTGAAGCAGCCTTTTGAGTTTTCTGCACAAGGAGGTCATGTGCTGCTTTCTGACATGTGGCCATACT
CCATAGGGGTGCCTGTTTTAGTTTTTGACGTTTGTTTTTTTGTCTTTGATTCCATATATATCGGGAGTGTAATGAACAATCTGGTTTATAGGACATGAGAACACAGGACATTTTTGTCAG
AATGTCGTTGGTTTTGGGGTGAGATCCTAAGCTTTTAGTTAAATAACCGGAAGGCACAGATTTTAGACACGAGAAGGGTCCCCCACCTTATGACCAAATCGAAACAAGTTGCAGTAACTT
TTGACTGTGCCGGTCGCTTTGGTCCATGCAGACTGAAAGCAGCTGTGCAGAGGCAGGACCGCAAATTGTCCTGCATAAAAAACCTTCCACTATTTGCCACTAGCTTTCACGTTCAGTCGC
GAAATTTCATTTTCTGGATGCTACCTTATTTATTTAGCCACGTTTTCATTAATCTGGCAAAAAAGTGCCAATGCTTTCCATCCATTGCTTAACATAATCCATGCAGCATACCGACAACAG
TAGCGTCCAACTCTGATTCTCTGAATCACTATTGGGCCCAAAATAGACCTAATGGGTCCAAATTACCAATTTGGCCCAGTAAACACACCAGGCCCAACCTACAAAACTGGACCAAATCCA
GAAAAAACAAACATCTGCAGCCCAAGTTTTGATTTGGCTCAAAATAGACCTAGTGGGTCCGTCCAACTTAGCTCTAATTTGGCCCAGTAAACACACGAGGCCCAACCTACAAAACAGGAC
CAAATCTAGCAGCTGGTAGCCCAAGTTTTTTTTTTGTGGAGATAACGGTAGCCCAAGTTTTGAATTGAACGATTTGTTGATGCAGGCGCGCACACGATCGGGGTGACGCACTGCGACAAG
TTCGTGCGGCGGATCTACACGTTCAAGCAGCGGCTGGCCTACAACCCGCCGATGAACCTTGAGTTCCTGCGCTCCCTGCGCCGTGTCTGCCCCATCAACTTCTCCCCGACGTCCTTCGCC
ATGCTGGACGCCACCACGCCCCGGGCCTTCGACAACGCCTACTTCAACAACCTCCGCTACAACAAGGGCCTGCTGGCCTCCGACCAGGTGCTCTTCACCGACCGCCGGTCCAGGCCCACC
GTCAACCTCTTTGCCGCCAATGCCACCGCCTTCAACGAAGCCTTCGTCGCCGCCATGGCCAAGCTCGGCAGGATCGGCATCAAGACCGGCGCTGGCGGCGAGGTGCGCCGCGTCTGCACC
GCCGTGAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGGGGAAGTAGTAGTAGCTGCAGCTGCGAGAAGAAGAAGCTCCTCCTGATGTGGTGGAGAGCGGGTGTCCTATTGGCTGCCGTGACACTGGCGGGCGTGGTGGACGCGCAGCAG
CTGCGGCAGAACTACTACGGCAGCAGCTGCCCGAGCGCCGAGTCGACGGTCCGGTCCGTGATCTCGCAGCACGTGCAGCAGAGCTTCGCCGTCGCGCCCGGCACGCTCCGCCTCTTCTTC
CACGACTGCTTCGTCCGG
GGTTGTGACGCGTCGGTGATGCTGATGGCGCCCAACGGGGACGATGAGAGCCACAGCGGCGCCGACGCGACGCTGTCGCCGGACGCCGTGGACGCCATCAAC
AAGGCCAAGGCGGCCGTCGAGGCGCTCCCGGGATGCGCCGGCAAGGTCTCCTGCGCCGACATCCTCGCCATGGCCGCGCGCGACGTCGTCTCCCTG
ACTGGCGGGCCGAGCTACAACGTG
GAGCTGGGGCGGCTGGACGGGAAAACGTTCAACAGGGCCATCGTGAAGCACGTCCTCCCGGGCCCCGGCTTCGACCTCAACCAGCTCAACGCGCTCTTCGCCAGCAACGGGCTCACGCAG
TTCGACATGATCGCGCTCTCCG
GCGCGCACACGATCGGGGTGACGCACTGCGACAAGTTCGTGCGGCGGATCTACACGTTCAAGCAGCGGCTGGCCTACAACCCGCCGATGAACCTTGAG
TTCCTGCGCTCCCTGCGCCGTGTCTGCCCCATCAACTTCTCCCCGACGTCCTTCGCCATGCTGGACGCCACCACGCCCCGGGCCTTCGACAACGCCTACTTCAACAACCTCCGCTACAAC
AAGGGCCTGCTGGCCTCCGACCAGGTGCTCTTCACCGACCGCCGGTCCAGGCCCACCGTCAACCTCTTTGCCGCCAATGCCACCGCCTTCAACGAAGCCTTCGTCGCCGCCATGGCCAAG
CTCGGCAGGATCGGCATCAAGACCGGCGCTGGCGGCGAGGTGCGCCGCGTCTGCACCGCCGTGAATTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGGG GAAGTAGTAG TAGCTGCAGC TGCGAGAAGA AGAAGCTCCT CCTGATGTGG TGGAGAGCGG GTGTCCTATT GGCTGCCGTG ACACTGGCGG GCGTGGTGGA CGCGCAGCAG  CTGCGGCAGA ACTACTACGG CAGCAGCTGC CCGAGCGCCG AGTCGACGGT CCGGTCCGTG ATCTCGCAGC ACGTGCAGCA GAGCTTCGCC GTCGCGCCCG GCACGCTCCG CCTCTTCTTC  CACGACTGCT TCGTCCGGGG TTGTGACGCG TCGGTGATGC TGATGGCGCC CAACGGGGAC GATGAGAGCC ACAGCGGCGC CGACGCGACG CTGTCGCCGG ACGCCGTGGA CGCCATCAAC  AAGGCCAAGG CGGCCGTCGA GGCGCTCCCG GGATGCGCCG GCAAGGTCTC CTGCGCCGAC ATCCTCGCCA TGGCCGCGCG CGACGTCGTC TCCCTGACTG GCGGGCCGAG CTACAACGTG  GAGCTGGGGC GGCTGGACGG GAAAACGTTC AACAGGGCCA TCGTGAAGCA CGTCCTCCCG GGCCCCGGCT TCGACCTCAA CCAGCTCAAC GCGCTCTTCG CCAGCAACGG GCTCACGCAG  TTCGACATGA TCGCGCTCTC CGGCGCGCAC ACGATCGGGG TGACGCACTG CGACAAGTTC GTGCGGCGGA TCTACACGTT CAAGCAGCGG CTGGCCTACA ACCCGCCGAT GAACCTTGAG  TTCCTGCGCT CCCTGCGCCG TGTCTGCCCC ATCAACTTCT CCCCGACGTC CTTCGCCATG CTGGACGCCA CCACGCCCCG GGCCTTCGAC AACGCCTACT TCAACAACCT CCGCTACAAC  AAGGGCCTGC TGGCCTCCGA CCAGGTGCTC TTCACCGACC GCCGGTCCAG GCCCACCGTC AACCTCTTTG CCGCCAATGC CACCGCCTTC AACGAAGCCT TCGTCGCCGC CATGGCCAAG  CTCGGCAGGA TCGGCATCAA GACCGGCGCT GGCGGCGAGG TGCGCCGCGT CTGCACCGCC GTGAATTAGG TTTTAGATGG TGTTCTGTTG TGGGCTTGAG TGTAGTGTGT TAGAGTGAGA  GGGGAAGACT GTTTTTGTCT TGTGGATGCA GCGCAGATGC AGGGGTGTTT TTTGATGCTG TGTATTTCTG TGTGGGGATT ATGCTAACCA TTCTTTTGAG ATGTGGGGTG GAATGGGAAA 
ATTGGAAGTT TGGTAGTGGT CGGTGTTGGG ATTGGTCACA TGGTTATTAG CTGAATCGAA TGCATTGTTA CTGCCTGTTG CATTGTTTTT TGTGGCAACT TCAGTTTCCC CTTG 

Retrieve as FASTA