Entry information : ZmPrx80
Entry ID 790
Creation 2005-12-09 (Christophe Dunand)
Last sequence changes 2005-12-09
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx80
Name ZmPrx80
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Cell culture
Endosperm
Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx80
start..stop
S start..stop
SbPrx104 585 0 1..337 1..336
SiPrx64 491 2e-176 1..337 1..333
OsPrx119 461 1e-164 1..337 1..333
BdiPrx111 458 2e-163 1..337 1..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 194573263..194573511 249 N° 2 194571814..194572005 192 N° 3 194571128..194571700 573  
complement(join(194571128..194571700,194571814..194572005,194573263..194573511))


exon

Literature and cross-references ZmPrx80
Literature Wen,T.J. et al., unpublished
Protein ref. UniProtKB:   B6U210 [5' end]   B4FBI1 [3' end]
DNA ref. GenBank:   AC197129.2 (68754..71138)
Cluster/Prediction ref. UniGene:   Zm.9971
Protein sequence: ZmPrx80
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (301)
PWM (Da):   %s   36160.2 (32621.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.77 (4.92) Peptide Signal:   %s   cut: 37 range:37-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEKRRRGSGGVPSLAVAVLAALLAAASMPSPPRVAAALSPDYYKDSCPGLESIVRYEVARKKNETVVTIPATLRLVFHDCMVGGCDAAVLIASKNNDAEKDAPDNESLAGDGFDTINRVKAAVEKRCPGVVSCADIIALAARDVVYLADGPYWRVELGRLDGLDSRASDVKGKLPDPDMHVKDLTPVFQRNGFTEVDMVALSGAHTVGFAHCSRFTDRLYSYGGARTDPSFNPAYAYQLKQACPIDVGPTIAVNMDPVSPIRFDNAYYANLQDGLGLFTSDQVLYADEATRPIVDMFAASQKDFFDAFVAAMLKLGRLGVKTGKDGEIRRVCTAFNH*

Retrieve as FASTA  
Remarks Completed sequence from genomic (chromo 1, introns 1 and 3) and 45 ESTs. Strain="B73".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAGCGACGGCGAGGCAGCGGCGGCGTGCCGTCCTTGGCGGTGGCGGTGCTGGCGGCGCTCCTGGCGGCGGCCTCGATGCCGTCGCCGCCCCGCGTGGCGGCCGCGCTGTCGCCG
GACTACTACAAGGACAGCTGCCCGGGCCTGGAGTCGATCGTGCGGTACGAGGTGGCGAGGAAGAAGAACGAGACGGTGGTCACCATCCCGGCGACGCTCCGCCTCGTCTTCCACGACTGC
ATGGTCGGG
GTGAGCGAAATCCTCCCCCTCCCCCTCGGTCGAGCTTATTACTCCTGTCCTCCTCTTCCTAATTTGCTTCCACCGCACCGCACCGCACTCGTCCGTGGCTCGTGCAGTCCT
TTGCTTGCTCCGAGATGCGCAATTCCAACGCTCTTATTGATCTACTGCTACCGCATTTGATTCTATTTCTATCGTTTGGTTCCCAGCTGATCTATATGGTTCGTGCGTGGCTGCGTGCTA
ACAGCAGAGTTTAGTTCCCCACTCTCACCATCCTCTCTCAGGCTCTCAAGCTTGCTCTGTTGTGGAGGAAATCAGAACCATTCTCTGTCGCCGTCTCCTTTTCCTCTGTTCAATCCAGGA
AGCCGTCATTGGTTGCAAGTTGCGCACTGCTTTTTCCAGTCAGATAACATGGGCTGTCTGTCGCCTGCCTCTTTGCTTCCCAGCCAGTTCCTCTCCTCCATTGGCTTGGCTCAATCGCGA
GCCCTGTGCTGCTCTTCTGAATCGTGCTGAAAAGAAAGAAAAGGAAATGGGGCTTGCCAAAAGCTACTGCACGGGCCGCTACAGGGCAAGGGCAGGCAGTGTTTGTTTAGCTGGCCGGCC
GGGGACGCAAGCGAACAACAGCTCGAGAGCCCCGCGTGGTCGTCGGTTGCGCGCATGTGACGACGCGGCTTTTCACCCGCCCTTCCGGATTATCAAATGCCAGCCGAGCAGCGGCAGCGG
CAGCGGCGTGCCCTGCCTTCTCGTCAGAAACCACGCCCCCCGAATCCCGAGCGCGTCGACCCGCCGAAAACCATCTGTTTGCCGGGTTCTGAAAATCGTCGCAGTTGCTTTGGCAGCCAG
ATCTCAATCATGTTTCACCAACTCACTTGCAGCTGTGGACTGTGGTTTGGTTTCGGTTTTTCAGACTGGTTGTATGCAGCTCGACAGCTGGTTCCATCTTGCATGCATGGTGCCAAGAAT
ATGACCAAGATGCTGCTTGCTGCCTCTGCCTCTCTCTCTCACACACACAGCTGCTAGTGGCATCCTGACAAGCAAGCAGCTGGCATCTTCTTCTTAGTCCAGTCTTTTTCTCTCACCCTT
TTCTTTTAATCTTTTTTTTTTCTGGTGACGCGTGACAAGCAAGCAGCTGGCATCTTGAAATCGTTATCGCAGCTATTACATTGCTTTTGTAATAATTCCTACTAAGACAATAGAAAAGAA
TAGAAAAAGAAACAAGTAAATAATGTGCCCTGCCGTTCCCCCCACCTCCACCCACCTCAACCGCAGGGCTGCGACGCCGCCGTCCTGATCGCGTCCAAGAACAACGACGCCGAGAAGGAC
GCGCCGGACAACGAGTCGCTCGCCGGCGACGGCTTCGACACCATCAACCGGGTCAAGGCGGCCGTCGAGAAGAGGTGCCCCGGCGTGGTGTCCTGCGCCGACATCATCGCGCTCGCCGCC
AGAGACGTCGTCTACCTG
GTAACCGCCGTCACCACCCCCTTCATGTCTCGAGTCCGTCAGTCAGTCCCGTCGTCGTCCCTCGACCAGCTGGTGACGTATCGGTATTCGGTGGTGACGAAC
TGGCAATGCAGGCGGATGGCCCCTACTGGCGCGTCGAGCTCGGCCGTCTGGACGGGCTCGATTCCAGGGCCAGCGACGTCAAGGGGAAGCTGCCGGACCCGGACATGCACGTCAAGGACC
TCACGCCGGTGTTCCAGCGGAACGGCTTCACGGAGGTGGACATGGTCGCGCTCTCCGGCGCGCACACCGTCGGCTTCGCGCACTGCAGCCGCTTCACCGACAGGCTCTACAGCTACGGCG
GCGCGCGGACGGACCCGTCGTTCAACCCCGCCTACGCGTACCAGCTCAAGCAGGCGTGCCCCATAGACGTCGGCCCCACCATCGCCGTCAACATGGACCCCGTCAGCCCCATCAGGTTCG
ACAACGCCTACTACGCCAACCTCCAGGACGGGCTGGGGCTCTTCACCTCCGACCAGGTGCTCTACGCCGACGAGGCGACCAGGCCCATCGTCGACATGTTCGCCGCCAGCCAGAAGGACT
TCTTCGATGCTTTCGTCGCCGCCATGCTCAAGCTGGGGAGGCTAGGGGTGAAGACGGGGAAGGACGGAGAGATCAGAAGAGTCTGCACTGCCTTCAACCATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAGCGACGGCGAGGCAGCGGCGGCGTGCCGTCCTTGGCGGTGGCGGTGCTGGCGGCGCTCCTGGCGGCGGCCTCGATGCCGTCGCCGCCCCGCGTGGCGGCCGCGCTGTCGCCG
GACTACTACAAGGACAGCTGCCCGGGCCTGGAGTCGATCGTGCGGTACGAGGTGGCGAGGAAGAAGAACGAGACGGTGGTCACCATCCCGGCGACGCTCCGCCTCGTCTTCCACGACTGC
ATGGTCGGG
GGCTGCGACGCCGCCGTCCTGATCGCGTCCAAGAACAACGACGCCGAGAAGGACGCGCCGGACAACGAGTCGCTCGCCGGCGACGGCTTCGACACCATCAACCGGGTCAAG
GCGGCCGTCGAGAAGAGGTGCCCCGGCGTGGTGTCCTGCGCCGACATCATCGCGCTCGCCGCCAGAGACGTCGTCTACCTG
GCGGATGGCCCCTACTGGCGCGTCGAGCTCGGCCGTCTG
GACGGGCTCGATTCCAGGGCCAGCGACGTCAAGGGGAAGCTGCCGGACCCGGACATGCACGTCAAGGACCTCACGCCGGTGTTCCAGCGGAACGGCTTCACGGAGGTGGACATGGTCGCG
CTCTCCGGCGCGCACACCGTCGGCTTCGCGCACTGCAGCCGCTTCACCGACAGGCTCTACAGCTACGGCGGCGCGCGGACGGACCCGTCGTTCAACCCCGCCTACGCGTACCAGCTCAAG
CAGGCGTGCCCCATAGACGTCGGCCCCACCATCGCCGTCAACATGGACCCCGTCAGCCCCATCAGGTTCGACAACGCCTACTACGCCAACCTCCAGGACGGGCTGGGGCTCTTCACCTCC
GACCAGGTGCTCTACGCCGACGAGGCGACCAGGCCCATCGTCGACATGTTCGCCGCCAGCCAGAAGGACTTCTTCGATGCTTTCGTCGCCGCCATGCTCAAGCTGGGGAGGCTAGGGGTG
AAGACGGGGAAGGACGGAGAGATCAGAAGAGTCTGCACTGCCTTCAACCATTAG

Retrieve as FASTA