Entry information : BdiPrx138 (Bradi5g27170)
Entry ID 7902
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx138 (Bradi5g27170)
Name (synonym) BdiPrx138 (Bradi5g27170)
Class Class III peroxidase    [Orthogroup: Prx161]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx138
start..stop
S start..stop
BdiPrx69 356 5e-123 1..332 1..347
BdiPrx136 327 7e-112 1..322 1..338
BdiPrx137 318 2e-108 37..318 39..319
HvPrx44 285 3e-95 6..332 3..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28056458..28056682 225 N° 2 28055531..28056304 774  
complement(join(28055531..28056304,28056458..28056682))


exon

Literature and cross-references BdiPrx138 (Bradi5g27170)
DNA ref. Phytozome 12:   Bd5 (28056682..28055531)
Protein sequence: BdiPrx138 (Bradi5g27170)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (306)
PWM (Da):   %s   35574.57 (32991.2) Transmb domain:   %s   i9-31o
PI (pH):   %s   5.32 (5.11) Peptide Signal:   %s   cut: 27 range:27-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWSNANKAVLAMGLVAALLFPAATASSALSYDFHDNSCPNLLNMVYNAVDAARQEDPGVVPGLLRITYHDCFPQGCDGSILLTGPNSEQKMPQNAGLRQSALDLIESIRDKVHLACGPTVSCADITNLATRVAVVQSGMPGYNVTLGRLDSLEPASAAQVAALPGPDLVVSELVDSFASRGLDTTDLVALSGAHTIGKTSCRSLKKRWGENADFVDLLHSFCARYPEHKVDLDVISPNDFDNQYYINLQRGVGVLNSDMALVRDDPYIRNLVNGFARDQGWFFSQFSNSMSKLANLPPKLQGNDGEIRFSCSKRNNGPMAADAHQGFSASA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, intron 1), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTGGAGCAATGCAAATAAGGCAGTGCTGGCCATGGGCCTCGTTGCCGCGCTGCTCTTCCCGGCAGCTACTGCATCGTCGGCCCTTTCCTATGACTTCCACGACAACTCGTGCCCG
AACCTGCTCAACATGGTTTACAATGCCGTGGACGCCGCCCGTCAGGAGGACCCCGGTGTCGTCCCCGGCCTGCTCCGCATCACTTACCACGACTGCTTTCCTCAG
GTAACTAAGTGCAGC
GTTGTTGTCAGAAAGAAAAAAAGTGTTCATGACACTTGTTTTTGAAACTTCTAAACACGATTCGCATACACGTAAGGATGGGTTTTGCATGCCTGATATTTTGGCAAATTAATATGTAAA
CGTGATCATCTCTGCTAGGGTTGCGACGGGTCGATCCTGCTGACGGGGCCCAACAGCGAGCAGAAGATGCCGCAGAACGCGGGGCTACGACAGAGCGCGCTGGACCTCATCGAGAGCATC
CGCGACAAGGTGCACCTCGCCTGCGGCCCCACCGTCTCGTGCGCCGACATCACCAACCTGGCCACCCGGGTGGCCGTCGTCCAGTCGGGGATGCCCGGCTACAACGTGACGCTGGGCCGG
CTCGACAGCCTGGAGCCCGCTTCGGCCGCCCAAGTGGCGGCCTTACCGGGCCCCGACTTGGTGGTGTCGGAGCTCGTCGACTCCTTCGCGAGCCGCGGCCTCGACACCACCGACCTGGTG
GCGCTCTCCGGCGCGCACACCATCGGGAAGACGAGCTGCCGCAGCTTGAAGAAGCGGTGGGGGGAGAACGCGGATTTCGTGGACCTGCTCCATAGCTTCTGCGCCAGGTACCCTGAGCAC
AAGGTGGACTTGGACGTGATCAGTCCCAACGATTTCGACAACCAGTACTACATCAACCTCCAGCGTGGTGTCGGGGTGCTCAACTCCGACATGGCGCTTGTCCGCGACGACCCCTACATC
AGGAACTTGGTCAACGGCTTCGCCCGTGACCAGGGCTGGTTCTTTAGCCAGTTCAGCAACTCCATGAGCAAGCTGGCGAATCTGCCGCCCAAGCTGCAGGGAAACGACGGCGAGATCCGA
TTCAGCTGCAGCAAGAGGAACAACGGACCCATGGCTGCCGACGCTCATCAGGGGTTTTCGGCCTCTGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTGGAGCAATGCAAATAAGGCAGTGCTGGCCATGGGCCTCGTTGCCGCGCTGCTCTTCCCGGCAGCTACTGCATCGTCGGCCCTTTCCTATGACTTCCACGACAACTCGTGCCCG
AACCTGCTCAACATGGTTTACAATGCCGTGGACGCCGCCCGTCAGGAGGACCCCGGTGTCGTCCCCGGCCTGCTCCGCATCACTTACCACGACTGCTTTCCTCAG
GGTTGCGACGGGTCG
ATCCTGCTGACGGGGCCCAACAGCGAGCAGAAGATGCCGCAGAACGCGGGGCTACGACAGAGCGCGCTGGACCTCATCGAGAGCATCCGCGACAAGGTGCACCTCGCCTGCGGCCCCACC
GTCTCGTGCGCCGACATCACCAACCTGGCCACCCGGGTGGCCGTCGTCCAGTCGGGGATGCCCGGCTACAACGTGACGCTGGGCCGGCTCGACAGCCTGGAGCCCGCTTCGGCCGCCCAA
GTGGCGGCCTTACCGGGCCCCGACTTGGTGGTGTCGGAGCTCGTCGACTCCTTCGCGAGCCGCGGCCTCGACACCACCGACCTGGTGGCGCTCTCCGGCGCGCACACCATCGGGAAGACG
AGCTGCCGCAGCTTGAAGAAGCGGTGGGGGGAGAACGCGGATTTCGTGGACCTGCTCCATAGCTTCTGCGCCAGGTACCCTGAGCACAAGGTGGACTTGGACGTGATCAGTCCCAACGAT
TTCGACAACCAGTACTACATCAACCTCCAGCGTGGTGTCGGGGTGCTCAACTCCGACATGGCGCTTGTCCGCGACGACCCCTACATCAGGAACTTGGTCAACGGCTTCGCCCGTGACCAG
GGCTGGTTCTTTAGCCAGTTCAGCAACTCCATGAGCAAGCTGGCGAATCTGCCGCCCAAGCTGCAGGGAAACGACGGCGAGATCCGATTCAGCTGCAGCAAGAGGAACAACGGACCCATG
GCTGCCGACGCTCATCAGGGGTTTTCGGCCTCTGCTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTGGA GCAATGCAAA TAAGGCAGTG CTGGCCATGG GCCTCGTTGC CGCGCTGCTC TTCCCGGCAG CTACTGCATC GTCGGCCCTT TCCTATGACT TCCACGACAA CTCGTGCCCG  AACCTGCTCA ACATGGTTTA CAATGCCGTG GACGCCGCCC GTCAGGAGGA CCCCGGTGTC GTCCCCGGCC TGCTCCGCAT CACTTACCAC GACTGCTTTC CTCAGGGTTG CGACGGGTCG  ATCCTGCTGA CGGGGCCCAA CAGCGAGCAG AAGATGCCGC AGAACGCGGG GCTACGACAG AGCGCGCTGG ACCTCATCGA GAGCATCCGC GACAAGGTGC ACCTCGCCTG CGGCCCCACC  GTCTCGTGCG CCGACATCAC CAACCTGGCC ACCCGGGTGG CCGTCGTCCA GTCGGGGATG CCCGGCTACA ACGTGACGCT GGGCCGGCTC GACAGCCTGG AGCCCGCTTC GGCCGCCCAA  GTGGCGGCCT TACCGGGCCC CGACTTGGTG GTGTCGGAGC TCGTCGACTC CTTCGCGAGC CGCGGCCTCG ACACCACCGA CCTGGTGGCG CTCTCCGGCG CGCACACCAT CGGGAAGACG  AGCTGCCGCA GCTTGAAGAA GCGGTGGGGG GAGAACGCGG ATTTCGTGGA CCTGCTCCAT AGCTTCTGCG CCAGGTACCC TGAGCACAAG GTGGACTTGG ACGTGATCAG TCCCAACGAT  TTCGACAACC AGTACTACAT CAACCTCCAG CGTGGTGTCG GGGTGCTCAA CTCCGACATG GCGCTTGTCC GCGACGACCC CTACATCAGG AACTTGGTCA ACGGCTTCGC CCGTGACCAG  GGCTGGTTCT TTAGCCAGTT CAGCAACTCC ATGAGCAAGC TGGCGAATCT GCCGCCCAAG CTGCAGGGAA ACGACGGCGA GATCCGATTC AGCTGCAGCA AGAGGAACAA CGGACCCATG 
GCTGCCGACG CTCATCAGGG GTTTTCGGCC TCTGCTTAAT ATGTTAAAGC ATGCCATGCG TGCATGTAGC AATAAAGAGC TAGCGATAGC TAGCCAGCCT ATATAT 

Retrieve as FASTA