Entry information : BdiPrx21 (bradi1g33730)
Entry ID 7908
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx21 (bradi1g33730)
Name (synonym) BdiPrx21 (bradi1g33730)
Class Class III peroxidase    [Orthogroup: Prx096]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx21
start..stop
S start..stop
OsPrx91 495 7e-179 6..314 8..319
SiPrx36 491 3e-177 1..314 1..318
SiPrx35 475 1e-170 1..314 1..319
SbPrx141 472 1e-169 16..314 21..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29275072..29275281 210 N° 2 29275407..29275604 198 N° 3 29275690..29275849 160 N° 4 29276075..29276451 377
join(29275072..29275281,29275407..29275604,29275690..29275849,29276075..29276451 )


exon

Literature and cross-references BdiPrx21 (bradi1g33730)
DNA ref. Phytozome 12:   Bd1 (29275072..29276451)
Protein sequence: BdiPrx21 (bradi1g33730)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (291)
PWM (Da):   %s   33712.47 (31478.2)  
PI (pH):   %s   5.61 (5.31) Peptide Signal:   %s   cut: 24 range:24-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANLRLALLAAAALLLSPAFAAAQLRTDYYATICPNLEAIVRGSVKYSMGQSPISAPAALRLFFHDCAVRGCDASIMIVNSNGDDEWRHPDDQSLKQEGFQTILDAKAAVDSDPQCRHKVSCADILALAARESVSQSGGPSYPVELGRYDGKISTKNSVVLPHADFNLDQLNGFFSGLGLSQTDMIALSGGHTMGAADCSFFQYRIGTDPSMDPNFAAQLGGTCVNSQSFAFLDGSTPVKFDNAYYKNLQAGRGLLGSDQVLHADVRSRGTVDYYAYDQGTFFYDFANAMTRLGRVGVKTAADGEIRRDCRFPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAACCTTCGGTTAGCCTTACTCGCCGCCGCCGCGCTCCTCCTCTCGCCGGCGTTTGCCGCAGCCCAGCTGAGGACGGATTACTATGCCACCATCTGCCCCAACCTGGAGGCCATT
GTCCGGGGCTCAGTGAAGTACTCCATGGGCCAGTCCCCCATCTCCGCTCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGG
GTACGCCCACGCAGGCAGAAACTTCTCTTG
GCTCTTGCCAATTGCCATGGATGCATTTATGATCAGTGCATTACTGACACGCTAGCTCTTGCTGTTTCGTATCGTTGTGCTTAATTGTGATGCAGGGCTGCGACGCGTCGATCATGATCG
TGAACTCGAACGGCGACGACGAGTGGCGGCACCCCGACGACCAGTCGCTGAAGCAGGAGGGGTTCCAGACGATCCTGGACGCCAAGGCCGCCGTCGACAGCGACCCGCAGTGCCGTCACA
AGGTGTCCTGCGCCGACATACTCGCCCTCGCCGCACGGGAATCCGTCAGCCAG
GTAACCATGATACTCCTACAAATTGATGAGCCACAGTACAGAAATGTTGCATTGCATTGATCATCTT
CAGTGCGGCTAATTGCAGAGCGGAGGGCCGAGCTACCCAGTGGAGCTAGGCAGGTACGACGGGAAAATCTCCACGAAGAACAGCGTCGTGCTGCCGCACGCCGACTTCAACCTCGACCAG
CTCAACGGCTTCTTCTCCGGATTGGGCCTCTCCCAGACCGACATGATCGCTCTATCAG
GTAACTGAACCAAAACTCCAGGCTTTTCCCTTCTCCATCATCGCACGCGCGCCGACTTCAAT
TCTCCTGCACTTCATTTGCTAGCTCTTTCCCATATCGCAATACTACACGTACGCTACTACGCCGACTTTAAATCTTTTAAGTTTGACACTTTGACTGTCTCGCACTCACGAATCACGATG
GCTTACGCGTGAATCTAACATCAATCCACTCAAATTGGAGCAGGCGGGCACACGATGGGCGCGGCGGACTGCAGCTTCTTCCAGTACAGGATCGGCACGGACCCGAGCATGGACCCAAAC
TTCGCGGCGCAGCTGGGCGGCACCTGCGTCAACAGCCAGAGCTTCGCGTTCCTGGACGGGTCCACGCCGGTCAAGTTCGACAACGCCTACTACAAGAACCTGCAGGCCGGCAGGGGCCTG
CTGGGCTCTGACCAGGTGCTGCACGCCGACGTCAGGTCCAGGGGCACCGTCGACTACTACGCCTACGACCAGGGCACCTTCTTCTACGACTTCGCCAACGCCATGACCAGGCTCGGCAGG
GTCGGGGTCAAGACGGCCGCCGACGGCGAGATTCGCCGCGACTGCAGGTTCCCCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAACCTTCGGTTAGCCTTACTCGCCGCCGCCGCGCTCCTCCTCTCGCCGGCGTTTGCCGCAGCCCAGCTGAGGACGGATTACTATGCCACCATCTGCCCCAACCTGGAGGCCATT
GTCCGGGGCTCAGTGAAGTACTCCATGGGCCAGTCCCCCATCTCCGCTCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCAGG
GGCTGCGACGCGTCGATCATGATCGTGAAC
TCGAACGGCGACGACGAGTGGCGGCACCCCGACGACCAGTCGCTGAAGCAGGAGGGGTTCCAGACGATCCTGGACGCCAAGGCCGCCGTCGACAGCGACCCGCAGTGCCGTCACAAGGTG
TCCTGCGCCGACATACTCGCCCTCGCCGCACGGGAATCCGTCAGCCAG
AGCGGAGGGCCGAGCTACCCAGTGGAGCTAGGCAGGTACGACGGGAAAATCTCCACGAAGAACAGCGTCGTG
CTGCCGCACGCCGACTTCAACCTCGACCAGCTCAACGGCTTCTTCTCCGGATTGGGCCTCTCCCAGACCGACATGATCGCTCTATCAG
GCGGGCACACGATGGGCGCGGCGGACTGCAGC
TTCTTCCAGTACAGGATCGGCACGGACCCGAGCATGGACCCAAACTTCGCGGCGCAGCTGGGCGGCACCTGCGTCAACAGCCAGAGCTTCGCGTTCCTGGACGGGTCCACGCCGGTCAAG
TTCGACAACGCCTACTACAAGAACCTGCAGGCCGGCAGGGGCCTGCTGGGCTCTGACCAGGTGCTGCACGCCGACGTCAGGTCCAGGGGCACCGTCGACTACTACGCCTACGACCAGGGC
ACCTTCTTCTACGACTTCGCCAACGCCATGACCAGGCTCGGCAGGGTCGGGGTCAAGACGGCCGCCGACGGCGAGATTCGCCGCGACTGCAGGTTCCCCAACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAACC TTCGGTTAGC CTTACTCGCC GCCGCCGCGC TCCTCCTCTC GCCGGCGTTT GCCGCAGCCC AGCTGAGGAC GGATTACTAT GCCACCATCT GCCCCAACCT GGAGGCCATT  GTCCGGGGCT CAGTGAAGTA CTCCATGGGC CAGTCCCCCA TCTCCGCTCC CGCCGCGCTC AGGCTCTTCT TCCACGACTG CGCCGTCAGG GGCTGCGACG CGTCGATCAT GATCGTGAAC  TCGAACGGCG ACGACGAGTG GCGGCACCCC GACGACCAGT CGCTGAAGCA GGAGGGGTTC CAGACGATCC TGGACGCCAA GGCCGCCGTC GACAGCGACC CGCAGTGCCG TCACAAGGTG  TCCTGCGCCG ACATACTCGC CCTCGCCGCA CGGGAATCCG TCAGCCAGAG CGGAGGGCCG AGCTACCCAG TGGAGCTAGG CAGGTACGAC GGGAAAATCT CCACGAAGAA CAGCGTCGTG  CTGCCGCACG CCGACTTCAA CCTCGACCAG CTCAACGGCT TCTTCTCCGG ATTGGGCCTC TCCCAGACCG ACATGATCGC TCTATCAGGC GGGCACACGA TGGGCGCGGC GGACTGCAGC  TTCTTCCAGT ACAGGATCGG CACGGACCCG AGCATGGACC CAAACTTCGC GGCGCAGCTG GGCGGCACCT GCGTCAACAG CCAGAGCTTC GCGTTCCTGG ACGGGTCCAC GCCGGTCAAG  TTCGACAACG CCTACTACAA GAACCTGCAG GCCGGCAGGG GCCTGCTGGG CTCTGACCAG GTGCTGCACG CCGACGTCAG GTCCAGGGGC ACCGTCGACT ACTACGCCTA CGACCAGGGC  ACCTTCTTCT ACGACTTCGC CAACGCCATG ACCAGGCTCG GCAGGGTCGG GGTCAAGACG GCCGCCGACG GCGAGATTCG CCGCGACTGC AGGTTCCCCA ACTAGTTCAG CTCGCCCTAT  ATATATGGAC CGGCCGGGGC GCGCTGGCGG GGCACATGTT GATAGGTCTA CTTAATTATT GCATGCTCCC ACTGTTGCTA GCCCATGGCG TCATGGCGAC TGTAACTCTG TAATAGTAAT  AAGCTCGATC ATGCATATGC TTGCATATTG CTCTGATTCA TGCATGGCCG AGAATAACAT GCAGATCTGT TGTACAAGTA CTTGCGTGGC AAATATGAGC CCGGTTCCAG CAGAAAAGAG 
TAAATTATCC TGTCGTGGCC AGATTGGCGC GCCAAAAATC AGCCGTATGT CCTAACTTCA TCAAACATCG ATCAAATGAG GATT 

Retrieve as FASTA