Entry information : BdiPrx40 (Bradi1g61540)
Entry ID 7912
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx40 (Bradi1g61540)
Name (synonym) BdiPrx40 (Bradi1g61540)
Class Class III peroxidase    [Orthogroup: Prx086]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx40
start..stop
S start..stop
TaPrx44 579 0 1..330 4..332
HvPrx28 576 0 1..330 4..332
TaPrx38 552 0 19..330 22..332
HvPrx24 530 0 19..328 24..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 60898289..60898507 219 N° 2 60897406..60898179 774  
complement(join(60897406..60898179,60898289..60898507))


exon

Literature and cross-references BdiPrx40 (Bradi1g61540)
DNA ref. Phytozome 12:   Bd1 (60898507..60897406)
EST ref. GenBank:   DV486039.1 [3' end]   DV487497.1 [3' end]
Protein sequence: BdiPrx40 (Bradi1g61540)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (308)
PWM (Da):   %s   34845.36 (32736.2) Transmb domain:   %s   i5-27o
PI (pH):   %s   4.77 (4.68) Peptide Signal:   %s   cut: 23 range:23-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKVAVLVACALLLLAVGCQASPYWPLEVGFYHDKCPQAEAVVKGVVANAIAQNPGNGAALIRMLFHDCFVEGCDASILLDATPFSPTPEKTSPPNDPTLRGFELIDAIKDAVEAACPGVVSCADILAFAARDASCVLSGGKADFTMPGGRRDGTYSNASEPLKFLVPPTSTLAELVDSFVVKGLNTEDLVILSGAHTVGRSHCSSFVPDRLLSPASDIGSGFAAFLRGQCPADATAGGNDAVVMQDVVTPDALDRQYYKNVLSHTVLFSSDAALLTSEETVRMVMDNANIPGWWEDRFKTSMVKMASIEVKTGFQGQIRKNCRAINYY*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1), 2 ESTs. Cultivar="Bd21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAAAGGTGGCCGTCTTGGTTGCATGTGCCTTGCTGCTCCTCGCCGTGGGGTGCCAGGCCAGCCCCTACTGGCCGCTAGAGGTAGGTTTCTACCACGACAAGTGCCCCCAGGCC
GAGGCCGTCGTGAAGGGCGTCGTCGCGAACGCCATCGCCCAGAACCCCGGCAATGGCGCCGCCCTCATCCGCATGCTCTTCCACGACTGCTTCGTCGAG
GTATGATTCAATTCATTAGCC
GGCCTTTTCAGATTTAAAGACATTCATCAGTAGGTTCTAGCCATTACACTTGACTGAACTGTTTGCTGGATGCATGCATGATTTCCAGGGCTGTGACGCTTCCATCTTGCTGGACGCGAC
CCCGTTCAGCCCGACGCCGGAGAAGACGAGCCCGCCCAACGACCCAACCCTGCGTGGCTTCGAGCTGATCGACGCCATCAAGGACGCCGTGGAGGCGGCCTGCCCAGGCGTGGTCTCCTG
CGCCGACATCCTGGCCTTCGCGGCCCGCGACGCGTCCTGCGTCCTCAGTGGTGGCAAGGCGGACTTCACCATGCCGGGCGGCCGCCGCGACGGCACCTACTCCAACGCCTCGGAGCCGCT
CAAGTTCCTCGTCCCGCCCACCTCCACACTGGCCGAGCTCGTGGACAGCTTCGTGGTCAAGGGGCTCAACACGGAGGACCTGGTCATCCTCTCGGGGGCACACACCGTGGGCCGGTCACA
CTGCTCGTCCTTCGTCCCCGACCGCCTCCTCAGCCCGGCCTCCGACATCGGCTCCGGCTTCGCGGCGTTCCTGCGGGGCCAGTGCCCCGCCGACGCAACGGCGGGGGGCAACGACGCCGT
GGTGATGCAGGACGTGGTGACGCCTGACGCGCTGGACAGGCAGTACTACAAGAACGTGTTGTCGCACACGGTGTTGTTTAGTTCCGACGCGGCGCTGCTGACATCGGAGGAGACGGTGAG
GATGGTGATGGACAACGCCAACATCCCCGGGTGGTGGGAGGACAGGTTCAAGACCTCCATGGTCAAGATGGCCAGCATCGAGGTCAAGACCGGCTTCCAGGGCCAGATCAGGAAGAACTG
CAGGGCCATCAACTACTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAAAGGTGGCCGTCTTGGTTGCATGTGCCTTGCTGCTCCTCGCCGTGGGGTGCCAGGCCAGCCCCTACTGGCCGCTAGAGGTAGGTTTCTACCACGACAAGTGCCCCCAGGCC
GAGGCCGTCGTGAAGGGCGTCGTCGCGAACGCCATCGCCCAGAACCCCGGCAATGGCGCCGCCCTCATCCGCATGCTCTTCCACGACTGCTTCGTCGAG
GGCTGTGACGCTTCCATCTTG
CTGGACGCGACCCCGTTCAGCCCGACGCCGGAGAAGACGAGCCCGCCCAACGACCCAACCCTGCGTGGCTTCGAGCTGATCGACGCCATCAAGGACGCCGTGGAGGCGGCCTGCCCAGGC
GTGGTCTCCTGCGCCGACATCCTGGCCTTCGCGGCCCGCGACGCGTCCTGCGTCCTCAGTGGTGGCAAGGCGGACTTCACCATGCCGGGCGGCCGCCGCGACGGCACCTACTCCAACGCC
TCGGAGCCGCTCAAGTTCCTCGTCCCGCCCACCTCCACACTGGCCGAGCTCGTGGACAGCTTCGTGGTCAAGGGGCTCAACACGGAGGACCTGGTCATCCTCTCGGGGGCACACACCGTG
GGCCGGTCACACTGCTCGTCCTTCGTCCCCGACCGCCTCCTCAGCCCGGCCTCCGACATCGGCTCCGGCTTCGCGGCGTTCCTGCGGGGCCAGTGCCCCGCCGACGCAACGGCGGGGGGC
AACGACGCCGTGGTGATGCAGGACGTGGTGACGCCTGACGCGCTGGACAGGCAGTACTACAAGAACGTGTTGTCGCACACGGTGTTGTTTAGTTCCGACGCGGCGCTGCTGACATCGGAG
GAGACGGTGAGGATGGTGATGGACAACGCCAACATCCCCGGGTGGTGGGAGGACAGGTTCAAGACCTCCATGGTCAAGATGGCCAGCATCGAGGTCAAGACCGGCTTCCAGGGCCAGATC
AGGAAGAACTGCAGGGCCATCAACTACTACTAA

Retrieve as FASTA