Entry information : BdiPrx101 (Bradi3g09140)
Entry ID 7918
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx101 (Bradi3g09140)
Name (synonym) BdiPrx101 (Bradi3g09140)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx101
start..stop
S start..stop
HvPrx13 512 0 4..322 6..322
BdiPrx99 496 5e-179 6..322 5..319
HvPrx15 495 1e-178 4..322 6..322
TmPrx06 490 2e-176 8..322 10..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7233075..7233284 210 N° 2 7233368..7233565 198 N° 3 7233679..7234242 564  
join(7233075..7233284,7233368..7233565,7233679..7234242)


exon

Literature and cross-references BdiPrx101 (Bradi3g09140)
DNA ref. Phytozome 12:   Bd3 (7233075..7234242)
Protein sequence: BdiPrx101 (Bradi3g09140)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (300)
PWM (Da):   %s   34989.44 (32539.3)  
PI (pH):   %s   6.84 (6.76) Peptide Signal:   %s   cut: 24 range:24-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWSTTTWHCLVALSLLSSAAYGQLNTKFYDYSCPHLEFIVRLSMFKAILTERRMGASLLRLHFHDCFVQGCDGSILLDDVPGKNFTGEKTAFPNVNSVRGFEVIDDIKRNVEYFCPGVVSCADILALAAREGTVLLGGPSWAVPLGRRDSTTASLDAANNDLPPPTLNLSALIQSFANKSLSARDLTALSGAHTIGFSQCLNFRDHVYNDTNIDPAFATLRRGNCPAAAPNGDTNLAPFDVQTQLRFDNAYYGNLLAKRGLIHSDQELFNGASQDALVQQYSANQALFFADFAAAMIKMGNLSPLTGNAGQIRRNCRAVNSS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 1 & 2), No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGGTCCACTACGACCTGGCATTGCCTTGTTGCTCTTTCCCTCCTCTCCTCCGCCGCCTACGGGCAGCTCAACACCAAGTTCTATGACTACAGCTGCCCGCACCTTGAGTTCATC
GTGCGCCTCAGCATGTTCAAGGCCATCCTCACCGAGCGCCGGATGGGCGCATCCCTCCTCAGGCTCCACTTCCACGACTGCTTTGTTCAG
GTACTCATATTCCGGACAGCACAAGGTTAC
TTACATTCGATCGTCATCAATTTACGATTGAGACATATAAAAAATTGTTTAAGGGATGTGACGGATCCATTCTTCTGGACGACGTGCCCGGGAAGAACTTCACCGGCGAGAAGACCGCGT
TTCCGAACGTGAACTCCGTCCGCGGTTTCGAGGTCATCGACGACATCAAGAGGAACGTGGAGTACTTCTGCCCCGGCGTCGTTTCCTGCGCCGACATCCTCGCCCTGGCCGCACGGGAGG
GCACCGTTCTG
GTACGTACATATATACCATACGTGCGTGTGCATGCATGCTTGACTCCGACATTGTGCCGATCTATATAACTTGAAATGCACACGCCTGATCTGGACATTGTGATATCGA
ACAGCTGGGCGGGCCAAGCTGGGCCGTGCCTCTGGGCCGGCGGGACTCGACAACGGCGAGCCTGGACGCAGCGAACAACGACCTCCCGCCGCCGACGCTAAACCTCAGCGCGCTCATCCA
GTCGTTCGCCAACAAGAGCCTGAGCGCGCGGGACCTGACGGCGCTCTCCGGCGCGCACACCATCGGCTTCTCGCAGTGCCTCAACTTCCGCGACCACGTCTACAACGACACCAACATCGA
CCCGGCGTTCGCGACTCTTCGCAGGGGCAACTGCCCCGCCGCGGCGCCCAACGGCGACACCAACCTGGCGCCCTTCGACGTGCAGACGCAGCTCCGCTTCGACAACGCCTACTACGGCAA
CCTGCTCGCCAAGCGCGGCCTGATCCACTCCGACCAGGAGCTCTTCAACGGCGCCTCCCAGGACGCGCTCGTGCAGCAGTACAGCGCCAACCAGGCGCTCTTCTTCGCCGACTTCGCGGC
GGCCATGATCAAGATGGGGAACCTTAGCCCGCTCACCGGGAACGCCGGCCAGATCAGGCGCAACTGTAGGGCCGTCAACAGCAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGGTCCACTACGACCTGGCATTGCCTTGTTGCTCTTTCCCTCCTCTCCTCCGCCGCCTACGGGCAGCTCAACACCAAGTTCTATGACTACAGCTGCCCGCACCTTGAGTTCATC
GTGCGCCTCAGCATGTTCAAGGCCATCCTCACCGAGCGCCGGATGGGCGCATCCCTCCTCAGGCTCCACTTCCACGACTGCTTTGTTCAG
GGATGTGACGGATCCATTCTTCTGGACGAC
GTGCCCGGGAAGAACTTCACCGGCGAGAAGACCGCGTTTCCGAACGTGAACTCCGTCCGCGGTTTCGAGGTCATCGACGACATCAAGAGGAACGTGGAGTACTTCTGCCCCGGCGTCGTT
TCCTGCGCCGACATCCTCGCCCTGGCCGCACGGGAGGGCACCGTTCTG
CTGGGCGGGCCAAGCTGGGCCGTGCCTCTGGGCCGGCGGGACTCGACAACGGCGAGCCTGGACGCAGCGAAC
AACGACCTCCCGCCGCCGACGCTAAACCTCAGCGCGCTCATCCAGTCGTTCGCCAACAAGAGCCTGAGCGCGCGGGACCTGACGGCGCTCTCCGGCGCGCACACCATCGGCTTCTCGCAG
TGCCTCAACTTCCGCGACCACGTCTACAACGACACCAACATCGACCCGGCGTTCGCGACTCTTCGCAGGGGCAACTGCCCCGCCGCGGCGCCCAACGGCGACACCAACCTGGCGCCCTTC
GACGTGCAGACGCAGCTCCGCTTCGACAACGCCTACTACGGCAACCTGCTCGCCAAGCGCGGCCTGATCCACTCCGACCAGGAGCTCTTCAACGGCGCCTCCCAGGACGCGCTCGTGCAG
CAGTACAGCGCCAACCAGGCGCTCTTCTTCGCCGACTTCGCGGCGGCCATGATCAAGATGGGGAACCTTAGCCCGCTCACCGGGAACGCCGGCCAGATCAGGCGCAACTGTAGGGCCGTC
AACAGCAGCTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGGT CCACTACGAC CTGGCATTGC CTTGTTGCTC TTTCCCTCCT CTCCTCCGCC GCCTACGGGC AGCTCAACAC CAAGTTCTAT GACTACAGCT GCCCGCACCT TGAGTTCATC  GTGCGCCTCA GCATGTTCAA GGCCATCCTC ACCGAGCGCC GGATGGGCGC ATCCCTCCTC AGGCTCCACT TCCACGACTG CTTTGTTCAG GGATGTGACG GATCCATTCT TCTGGACGAC  GTGCCCGGGA AGAACTTCAC CGGCGAGAAG ACCGCGTTTC CGAACGTGAA CTCCGTCCGC GGTTTCGAGG TCATCGACGA CATCAAGAGG AACGTGGAGT ACTTCTGCCC CGGCGTCGTT  TCCTGCGCCG ACATCCTCGC CCTGGCCGCA CGGGAGGGCA CCGTTCTGCT GGGCGGGCCA AGCTGGGCCG TGCCTCTGGG CCGGCGGGAC TCGACAACGG CGAGCCTGGA CGCAGCGAAC  AACGACCTCC CGCCGCCGAC GCTAAACCTC AGCGCGCTCA TCCAGTCGTT CGCCAACAAG AGCCTGAGCG CGCGGGACCT GACGGCGCTC TCCGGCGCGC ACACCATCGG CTTCTCGCAG  TGCCTCAACT TCCGCGACCA CGTCTACAAC GACACCAACA TCGACCCGGC GTTCGCGACT CTTCGCAGGG GCAACTGCCC CGCCGCGGCG CCCAACGGCG ACACCAACCT GGCGCCCTTC  GACGTGCAGA CGCAGCTCCG CTTCGACAAC GCCTACTACG GCAACCTGCT CGCCAAGCGC GGCCTGATCC ACTCCGACCA GGAGCTCTTC AACGGCGCCT CCCAGGACGC GCTCGTGCAG  CAGTACAGCG CCAACCAGGC GCTCTTCTTC GCCGACTTCG CGGCGGCCAT GATCAAGATG GGGAACCTTA GCCCGCTCAC CGGGAACGCC GGCCAGATCA GGCGCAACTG TAGGGCCGTC  AACAGCAGCT GATCGTCGAC TCTCCTAATT TCAAACTTCG TTCTGCCAAG ATTTTATAAG TTCTGTACGT CGTTTGTCGT CAAACACCTC AAGTATTTTA TTTTATTTTC CCCGGGCACC  TCTGCGGGTT TTCTTTTTAC TTTCTATTTT GGTCAAATTA ATTAAGTCCC ACCTCTGCCG CAAGCACTTT GCACGTGTCA GTGCCTTTAC TGTTATTATA ACCACTTGCT GTTATATTCT 
GGGACGCAAG CCATTTG 

Retrieve as FASTA