Entry information : BdiPrx102 (Bradi3g10460)
Entry ID 7919
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx102 (Bradi3g10460)
Name (synonym) BdiPrx102 (Bradi3g10460)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx102
start..stop
S start..stop
BdiPrx103 595 0 18..322 18..322
OsPrx121 484 4e-174 16..322 21..328
OsPrx120 471 8e-169 16..322 22..331
SiPrx158 457 1e-163 3..322 8..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8647531..8647743 213 N° 2 8646687..8647442 756  
complement(join(8646687..8647442,8647531..8647743))


exon

Literature and cross-references BdiPrx102 (Bradi3g10460)
DNA ref. Phytozome 12:   Bd3 (8647743..8646687)
Protein sequence: BdiPrx102 (Bradi3g10460)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (303)
PWM (Da):   %s   34382.87 (32546.8)  
PI (pH):   %s   8.96 (8.96) Peptide Signal:   %s   cut: 20 range:20-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSAVLLLVSLAVLPLATGSNAQLQNGFCKGKCGSNDVEAIVQGVVKARFSRDATIVAHLLRLLFHECGVNGCDGGLLIDGFGTEKTALPNLSVKGYDLIAEIKTELERRCPRVVSCSDIEILATRDAIALAGGAKYLVRTGRRDGRQSRASDVNLPAANSTVAQATSFFGRLGLSQFDMALLLGAHTVGVTHCSVVKGRLYSHGGKAGATDPSLDPSLASVFKKFVCPNTPSSDNNIVFLDDQPSALRVDNGYYKMLQRRRGVLSIDQNLYGDGSTRWIVDMLANTDNFRALFPQALVKLGEVKVLTGAQGEIRKVCNRFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 1), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCCGCAGTGTTGCTACTTGTTTCGTTGGCGGTGCTGCCGCTGGCCACCGGAAGCAACGCGCAGCTGCAGAACGGGTTCTGCAAGGGCAAGTGTGGCTCCAACGACGTGGAGGCC
ATCGTGCAGGGCGTCGTCAAGGCCCGCTTCTCCCGGGACGCCACCATCGTCGCCCACCTCCTGCGCCTGCTGTTCCACGAGTGCGGCGTCAAT
GTACGTATTTTTACTCGCCAATGCACT
CTCCATCCTGTGTCTATTAGTACTGTAATTCATAACTGTGGATGCTTCAAATGAACTGCAGGGGTGCGACGGCGGGCTGCTGATCGACGGCTTTGGCACGGAGAAGACGGCATTGCCGAA
CCTGAGTGTCAAGGGATACGACCTGATCGCGGAGATCAAAACTGAGCTCGAGAGACGGTGCCCGCGCGTGGTTTCCTGCTCCGACATCGAGATCCTGGCCACCAGGGACGCCATCGCTCT
GGCCGGCGGGGCAAAATACTTGGTGCGCACCGGCAGGAGGGACGGCCGGCAGTCCAGGGCCTCCGACGTGAACCTGCCGGCGGCAAACAGCACGGTGGCTCAGGCCACCTCTTTCTTCGG
CAGGCTCGGGCTCAGCCAGTTCGACATGGCCCTTCTCCTGGGCGCGCACACGGTGGGCGTCACGCATTGCAGCGTGGTCAAGGGCAGGCTGTACAGCCACGGCGGCAAGGCCGGCGCCAC
GGACCCAAGCCTGGACCCGAGCCTGGCATCCGTGTTCAAGAAATTCGTGTGCCCCAACACGCCGTCGTCGGACAACAACATCGTCTTCCTGGACGACCAGCCCAGCGCGCTCAGGGTGGA
CAACGGCTACTACAAGATGCTCCAGCGGCGGCGCGGCGTGCTGTCTATCGACCAGAACCTCTACGGAGACGGCTCCACGCGGTGGATCGTCGACATGCTCGCCAACACCGACAACTTCCG
TGCGCTCTTCCCGCAGGCGCTCGTCAAGCTCGGCGAGGTTAAGGTGCTCACTGGCGCACAGGGAGAGATCCGCAAGGTCTGCAACAGGTTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCCGCAGTGTTGCTACTTGTTTCGTTGGCGGTGCTGCCGCTGGCCACCGGAAGCAACGCGCAGCTGCAGAACGGGTTCTGCAAGGGCAAGTGTGGCTCCAACGACGTGGAGGCC
ATCGTGCAGGGCGTCGTCAAGGCCCGCTTCTCCCGGGACGCCACCATCGTCGCCCACCTCCTGCGCCTGCTGTTCCACGAGTGCGGCGTCAAT
GGGTGCGACGGCGGGCTGCTGATCGAC
GGCTTTGGCACGGAGAAGACGGCATTGCCGAACCTGAGTGTCAAGGGATACGACCTGATCGCGGAGATCAAAACTGAGCTCGAGAGACGGTGCCCGCGCGTGGTTTCCTGCTCCGACATC
GAGATCCTGGCCACCAGGGACGCCATCGCTCTGGCCGGCGGGGCAAAATACTTGGTGCGCACCGGCAGGAGGGACGGCCGGCAGTCCAGGGCCTCCGACGTGAACCTGCCGGCGGCAAAC
AGCACGGTGGCTCAGGCCACCTCTTTCTTCGGCAGGCTCGGGCTCAGCCAGTTCGACATGGCCCTTCTCCTGGGCGCGCACACGGTGGGCGTCACGCATTGCAGCGTGGTCAAGGGCAGG
CTGTACAGCCACGGCGGCAAGGCCGGCGCCACGGACCCAAGCCTGGACCCGAGCCTGGCATCCGTGTTCAAGAAATTCGTGTGCCCCAACACGCCGTCGTCGGACAACAACATCGTCTTC
CTGGACGACCAGCCCAGCGCGCTCAGGGTGGACAACGGCTACTACAAGATGCTCCAGCGGCGGCGCGGCGTGCTGTCTATCGACCAGAACCTCTACGGAGACGGCTCCACGCGGTGGATC
GTCGACATGCTCGCCAACACCGACAACTTCCGTGCGCTCTTCCCGCAGGCGCTCGTCAAGCTCGGCGAGGTTAAGGTGCTCACTGGCGCACAGGGAGAGATCCGCAAGGTCTGCAACAGG
TTCAACTGA

Retrieve as FASTA