Entry information : ZmPrx82 (Peroxidase 1)
Entry ID 792
Creation 2005-12-12 (Christophe Dunand)
Last sequence changes 2011-02-23 (Christophe Dunand)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2011-02-23 (Christophe Dunand)
Peroxidase information: ZmPrx82 (Peroxidase 1)
Name (synonym) ZmPrx82 (Peroxidase 1)
Class Class III peroxidase    [Orthogroup: Prx052]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Embryos
Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx82
start..stop
S start..stop
SbPrx131 562 0 1..333 1..331
SiPrx32 545 0 23..333 21..327
SbPrx145 544 0 23..333 22..329
ZmPrx98 534 0 1..333 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 41754378..41754602 225 N° 2 41753466..41754242 777  
complement(join(41753466..41754242,41754378..41754602))


exon

Literature and cross-references ZmPrx82 (Peroxidase 1)
Literature Alexandrov,N.N., Brover,V.V., Freidin,S., Troukhan,M.E., Tatarinova,T.V., Zhang,H., Swaller,T.J., Lu,Y.P., Bouck,J., Flavell,R.B. and Feldmann,K.A. Insights into corn genes derived from large-scale cDNA sequencing. Plant Mol. Biol. 69 (1-2), 179-194 (2009)
Protein ref. UniProtKB:   B6TMI9 [Incorrect splicing]
mRNA ref. GenBank:   NM_001156763
Cluster/Prediction ref. UniGene:   Zm.8649
Protein sequence: ZmPrx82 (Peroxidase 1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (305)
PWM (Da):   %s   35233.87 (32382.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.93 (7.36) Peptide Signal:   %s   cut: 29 range:29-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFRSCLVRLLLPMAALLLLAASSPAAAQLVAGYYSKTCPDAEAIVRNETEKIIAAAPSLAGPLLRLHFHDCFVRGCDASVLLDDPNGGNKAEKDAKPNRSLRGFGSVERVKAKLEAACPSTVSCADVLALMARDAVVLAKGPSWPVALGRRDGRVSSATEAADSLPPAFGDVPLLAKIFAANGLDLKDLAVLSGAHTLGTAHCPSYAGRLYNFSSAYGGADPSLDSEYADRLRTRCGSVDDTATLSEMDPGSYKTFDTSYYRHVAKRRGLFQSDAALLADATTREYVLRMATGRFDGVFFQDFGESMIKMGNAGVLTGAAQGEIRKKCYIVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, intron 1) and 8 ESTs. The contig also contains ZmPrx98. Also found in AC206948.3.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCAGGTCTTGTCTAGTACGGCTGCTGCTCCCTATGGCAGCACTGCTTCTGCTCGCTGCCAGCTCGCCCGCGGCGGCTCAGCTGGTGGCCGGCTACTACAGCAAGACATGCCCG
GACGCCGAGGCCATCGTCCGCAACGAGACGGAGAAGATCATCGCCGCCGCGCCCAGCCTCGCCGGCCCACTTCTCAGGCTCCATTTCCACGACTGCTTCGTCAGG
GTAAGTGGTGGTACA
ACATGTCGTCGCAGATCGCAGTAGCGACTGGCGAGATTTCATTTGATCATTGCATGTGTAGTCGAATACTTACAGAAACATTCATCTGCATGCATGCGTGGTGCAAAAATCAAATTCCAG

GGTTGCGACGCCTCGGTCCTGCTCGACGACCCCAACGGGGGTAACAAGGCCGAGAAGGACGCCAAGCCGAACAGGAGCCTGCGGGGCTTCGGCTCCGTGGAGAGAGTGAAGGCCAAGCTG
GAAGCCGCATGCCCCAGCACGGTTTCCTGCGCCGACGTCCTGGCCCTGATGGCCCGCGACGCCGTGGTGCTCGCCAAGGGCCCATCCTGGCCAGTGGCCCTGGGGAGGCGAGACGGCAGG
GTGTCGAGCGCCACGGAAGCGGCCGACAGCCTGCCTCCTGCCTTCGGCGACGTCCCGCTGCTCGCCAAGATCTTCGCCGCCAACGGCCTCGACCTCAAGGACCTGGCCGTGCTCTCCGGC
GCACACACCCTCGGCACGGCGCACTGCCCGTCGTACGCCGGCCGGCTCTACAACTTCAGCAGCGCATACGGCGGCGCGGACCCGTCCCTCGACAGCGAGTACGCCGACCGGCTGAGGACG
CGCTGCGGGAGCGTCGACGACACGGCCACGCTCTCCGAGATGGACCCCGGCAGCTACAAGACCTTCGACACGAGCTACTACCGCCACGTAGCCAAGCGGAGGGGCCTCTTCCAGTCCGAC
GCCGCGCTGCTCGCCGACGCCACCACCAGGGAGTACGTCCTGCGCATGGCCACCGGCAGGTTCGACGGCGTGTTCTTCCAGGACTTCGGCGAGTCCATGATCAAGATGGGCAACGCTGGC
GTGCTCACCGGTGCTGCTCAGGGGGAGATCAGGAAGAAATGCTACATCGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCAGGTCTTGTCTAGTACGGCTGCTGCTCCCTATGGCAGCACTGCTTCTGCTCGCTGCCAGCTCGCCCGCGGCGGCTCAGCTGGTGGCCGGCTACTACAGCAAGACATGCCCG
GACGCCGAGGCCATCGTCCGCAACGAGACGGAGAAGATCATCGCCGCCGCGCCCAGCCTCGCCGGCCCACTTCTCAGGCTCCATTTCCACGACTGCTTCGTCAGG
GGTTGCGACGCCTCG
GTCCTGCTCGACGACCCCAACGGGGGTAACAAGGCCGAGAAGGACGCCAAGCCGAACAGGAGCCTGCGGGGCTTCGGCTCCGTGGAGAGAGTGAAGGCCAAGCTGGAAGCCGCATGCCCC
AGCACGGTTTCCTGCGCCGACGTCCTGGCCCTGATGGCCCGCGACGCCGTGGTGCTCGCCAAGGGCCCATCCTGGCCAGTGGCCCTGGGGAGGCGAGACGGCAGGGTGTCGAGCGCCACG
GAAGCGGCCGACAGCCTGCCTCCTGCCTTCGGCGACGTCCCGCTGCTCGCCAAGATCTTCGCCGCCAACGGCCTCGACCTCAAGGACCTGGCCGTGCTCTCCGGCGCACACACCCTCGGC
ACGGCGCACTGCCCGTCGTACGCCGGCCGGCTCTACAACTTCAGCAGCGCATACGGCGGCGCGGACCCGTCCCTCGACAGCGAGTACGCCGACCGGCTGAGGACGCGCTGCGGGAGCGTC
GACGACACGGCCACGCTCTCCGAGATGGACCCCGGCAGCTACAAGACCTTCGACACGAGCTACTACCGCCACGTAGCCAAGCGGAGGGGCCTCTTCCAGTCCGACGCCGCGCTGCTCGCC
GACGCCACCACCAGGGAGTACGTCCTGCGCATGGCCACCGGCAGGTTCGACGGCGTGTTCTTCCAGGACTTCGGCGAGTCCATGATCAAGATGGGCAACGCTGGCGTGCTCACCGGTGCT
GCTCAGGGGGAGATCAGGAAGAAATGCTACATCGTCAACTAA

Retrieve as FASTA