Entry information : BdiPrx103 (Bradi3g10470)
Entry ID 7920
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx103 (Bradi3g10470)
Name (synonym) BdiPrx103 (Bradi3g10470)
Class Class III peroxidase    [Orthogroup: Prx120]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx103
start..stop
S start..stop
BdiPrx102 598 0 16..322 16..322
OsPrx121 491 8e-177 15..322 20..328
OsPrx120 478 1e-171 15..322 21..331
SiPrx158 452 1e-161 3..322 8..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8652820..8653032 213 N° 2 8653128..8653883 756  
join(8652820..8653032,8653128..8653883)


exon

Literature and cross-references BdiPrx103 (Bradi3g10470)
DNA ref. Phytozome 12:   Bd3 (8652820..8653883)
Protein sequence: BdiPrx103 (Bradi3g10470)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (300)
PWM (Da):   %s   34460.88 (32467.8)  
PI (pH):   %s   8.91 (9.10) Peptide Signal:   %s   cut: 23 range:23-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAVLLVVALAVLGLATGGDAQLQNGFYRGKCGSNDVEAIVQGVVRARFARDPKIVAFLLRLLFHECGVNGCDGGLLIDGFGTEKTALPNLSVNGYDLIAEIKTELERRCPRVVSCSDIEILATRDAVALAGGAKYLVRTGRRDGRQSRASDVNLPAPNSTVAQATSFFGRLGLSQFDMALLLGAHTVGVTHCGVIKGRLYSHGGKAGATDPSLDPSLASVFKKFVCPNTPSSDNNIVFLDDQPSALRVDNGYYKMLQRRRGVLSVDQNLYGDGSTRWIVDMLANTDNFRAFFPQALVKLGEVKVLTGAQGEIRRVCNRFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 1), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCGCAGTGTTGCTAGTTGTGGCTCTGGCGGTTCTGGGGCTCGCCACCGGAGGCGACGCGCAGCTGCAGAACGGGTTCTACAGGGGCAAGTGCGGCTCCAACGACGTGGAGGCC
ATCGTGCAGGGCGTGGTCAGGGCCCGCTTCGCCAGGGACCCCAAAATCGTCGCCTTTCTCCTGCGCCTGCTGTTCCACGAGTGCGGCGTCAAT
GTACGTGTTTTTACTCGCCAATGCACT
CTCCATCATGTCTATTGTTAGTACTCCGTACTGTAGTTCATAGTGTGGATGCTACAAATGAACTGCAGGGGTGCGACGGCGGGTTGCTGATCGACGGCTTTGGCACGGAGAAGACGGCAT
TGCCGAACCTGAGTGTAAACGGATACGACCTCATCGCGGAGATCAAAACTGAGCTCGAGAGACGGTGCCCGCGCGTGGTTTCCTGCTCCGACATCGAGATCCTGGCCACCAGGGACGCCG
TCGCTCTGGCCGGCGGGGCAAAATACTTGGTGCGCACGGGCAGGAGGGACGGCCGGCAGTCCAGGGCCTCCGACGTGAACCTGCCGGCGCCAAACAGCACGGTGGCGCAGGCCACCTCTT
TCTTCGGCAGGCTCGGGCTCAGCCAGTTCGACATGGCCCTTCTCCTGGGAGCCCACACGGTGGGCGTCACGCACTGCGGCGTGATCAAGGGCAGGCTGTACAGCCACGGCGGCAAGGCCG
GCGCCACGGACCCAAGCCTGGACCCGAGCCTGGCATCCGTGTTCAAGAAATTCGTGTGCCCCAACACGCCGTCGTCGGACAACAACATCGTCTTCCTGGACGACCAGCCCAGCGCGCTCA
GGGTGGACAACGGCTACTACAAGATGCTCCAGCGGCGGCGCGGCGTGCTTTCGGTGGACCAGAACCTCTACGGCGACGGCTCCACGCGGTGGATCGTCGACATGCTCGCCAACACCGACA
ACTTCCGTGCATTCTTCCCGCAGGCGCTCGTCAAGCTCGGCGAGGTTAAGGTTCTCACTGGCGCGCAGGGAGAGATCCGCAGGGTCTGCAACAGGTTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCGCAGTGTTGCTAGTTGTGGCTCTGGCGGTTCTGGGGCTCGCCACCGGAGGCGACGCGCAGCTGCAGAACGGGTTCTACAGGGGCAAGTGCGGCTCCAACGACGTGGAGGCC
ATCGTGCAGGGCGTGGTCAGGGCCCGCTTCGCCAGGGACCCCAAAATCGTCGCCTTTCTCCTGCGCCTGCTGTTCCACGAGTGCGGCGTCAAT
GGGTGCGACGGCGGGTTGCTGATCGAC
GGCTTTGGCACGGAGAAGACGGCATTGCCGAACCTGAGTGTAAACGGATACGACCTCATCGCGGAGATCAAAACTGAGCTCGAGAGACGGTGCCCGCGCGTGGTTTCCTGCTCCGACATC
GAGATCCTGGCCACCAGGGACGCCGTCGCTCTGGCCGGCGGGGCAAAATACTTGGTGCGCACGGGCAGGAGGGACGGCCGGCAGTCCAGGGCCTCCGACGTGAACCTGCCGGCGCCAAAC
AGCACGGTGGCGCAGGCCACCTCTTTCTTCGGCAGGCTCGGGCTCAGCCAGTTCGACATGGCCCTTCTCCTGGGAGCCCACACGGTGGGCGTCACGCACTGCGGCGTGATCAAGGGCAGG
CTGTACAGCCACGGCGGCAAGGCCGGCGCCACGGACCCAAGCCTGGACCCGAGCCTGGCATCCGTGTTCAAGAAATTCGTGTGCCCCAACACGCCGTCGTCGGACAACAACATCGTCTTC
CTGGACGACCAGCCCAGCGCGCTCAGGGTGGACAACGGCTACTACAAGATGCTCCAGCGGCGGCGCGGCGTGCTTTCGGTGGACCAGAACCTCTACGGCGACGGCTCCACGCGGTGGATC
GTCGACATGCTCGCCAACACCGACAACTTCCGTGCATTCTTCCCGCAGGCGCTCGTCAAGCTCGGCGAGGTTAAGGTTCTCACTGGCGCGCAGGGAGAGATCCGCAGGGTCTGCAACAGG
TTCAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCG CAGTGTTGCT AGTTGTGGCT CTGGCGGTTC TGGGGCTCGC CACCGGAGGC GACGCGCAGC TGCAGAACGG GTTCTACAGG GGCAAGTGCG GCTCCAACGA CGTGGAGGCC  ATCGTGCAGG GCGTGGTCAG GGCCCGCTTC GCCAGGGACC CCAAAATCGT CGCCTTTCTC CTGCGCCTGC TGTTCCACGA GTGCGGCGTC AATGGGTGCG ACGGCGGGTT GCTGATCGAC  GGCTTTGGCA CGGAGAAGAC GGCATTGCCG AACCTGAGTG TAAACGGATA CGACCTCATC GCGGAGATCA AAACTGAGCT CGAGAGACGG TGCCCGCGCG TGGTTTCCTG CTCCGACATC  GAGATCCTGG CCACCAGGGA CGCCGTCGCT CTGGCCGGCG GGGCAAAATA CTTGGTGCGC ACGGGCAGGA GGGACGGCCG GCAGTCCAGG GCCTCCGACG TGAACCTGCC GGCGCCAAAC  AGCACGGTGG CGCAGGCCAC CTCTTTCTTC GGCAGGCTCG GGCTCAGCCA GTTCGACATG GCCCTTCTCC TGGGAGCCCA CACGGTGGGC GTCACGCACT GCGGCGTGAT CAAGGGCAGG  CTGTACAGCC ACGGCGGCAA GGCCGGCGCC ACGGACCCAA GCCTGGACCC GAGCCTGGCA TCCGTGTTCA AGAAATTCGT GTGCCCCAAC ACGCCGTCGT CGGACAACAA CATCGTCTTC  CTGGACGACC AGCCCAGCGC GCTCAGGGTG GACAACGGCT ACTACAAGAT GCTCCAGCGG CGGCGCGGCG TGCTTTCGGT GGACCAGAAC CTCTACGGCG ACGGCTCCAC GCGGTGGATC  GTCGACATGC TCGCCAACAC CGACAACTTC CGTGCATTCT TCCCGCAGGC GCTCGTCAAG CTCGGCGAGG TTAAGGTTCT CACTGGCGCG CAGGGAGAGA TCCGCAGGGT CTGCAACAGG  TTCAACTGAT CGTTTTTCAT TTCATTCAAG CTCTGTGTGC GGTGCCTGCG TGCCTCGTCG ACGCTCGTGT GATCGACGAA TTACTCAATC AATTCCGTTC TTGTGTTAAC TAATTCCGGG  TTTGGTCATC CGATCGATGC TTTTTTGTTT TCCATTTGGT TTTGGTCAAA TCAGTTTTGA CCCGATTTGT TTTGCCTTAC ATTGGACAGA TTTTGTAATA AGTTGCACGA TCAGTAAGAA 
TTGAGAAAGA GTTACGGAAT GTAATTGTTG TCACGAATAT AGTCTCGTAA AATGTGAACC TTACTTTACC TAAAATTATT TA 

Retrieve as FASTA