Entry information : BdiPrx108 (Bradi3g32130)
Entry ID 7921
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx108 (Bradi3g32130)
Name (synonym) BdiPrx108 (Bradi3g32130)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx108
start..stop
S start..stop
OsPrx128 498 2e-179 4..319 11..337
ZmPrx05 488 6e-176 6..319 4..318
SiPrx164 476 3e-171 1..319 3..322
SbPrx12 475 1e-170 6..319 9..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34395331..34395732 402 N° 2 34396099..34396659 561  
join(34395331..34395732,34396099..34396659)


exon

Literature and cross-references BdiPrx108 (Bradi3g32130)
DNA ref. Phytozome 12:   Bd3 (34395331..34396659)
Protein sequence: BdiPrx108 (Bradi3g32130)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (296)
PWM (Da):   %s   32657.13 (30229.8)  
PI (pH):   %s   5.67 (5.65) Peptide Signal:   %s   cut: 25 range:25-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEAMRLLVQVAVTSALLMAAAVSAQLRVGFYDSSCPAAEIIVQQEVSSAVAANPGLAAGLLRLHFHDCFVGGCEASVLVDSTASNTAEKDAGPNKSLRGFEVIDRIKARVEQACFGVVSCADILAFAARDGIALTGGNGYQVPAGRRDGSVSKASDTSGNLPPPTPSVPQLTAIFASKGLTQKDMVTLSGAHTIGGSHCTSFSSRLQTPGPQTPDPTMDPGYVAQLASQCSSSSSGMVPMDAVTPNTFDEGYFKGVMANRGLLASDQALLGDGATAGQVVAYANDPATFQSDFAAAMVKMGYVGVLTGSSGKIRANCRVV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 2), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGCGATGCGGCTGCTCGTCCAAGTGGCGGTCACATCAGCGTTGCTGATGGCGGCGGCGGTGTCGGCGCAGCTGCGGGTGGGGTTCTACGACAGCTCGTGCCCGGCGGCAGAGATC
ATCGTTCAGCAGGAAGTGAGCAGCGCGGTGGCAGCCAACCCGGGCCTCGCCGCCGGCCTCCTCCGGCTGCATTTCCACGACTGCTTCGTGGGAGGCTGCGAGGCGTCGGTGCTGGTGGAC
TCGACGGCGAGCAACACGGCGGAGAAGGACGCCGGGCCGAACAAGAGCCTCCGTGGGTTCGAGGTGATCGACCGGATCAAGGCCCGGGTGGAGCAGGCGTGCTTCGGCGTCGTCTCCTGC
GCCGACATCCTCGCCTTCGCCGCCAGGGACGGCATCGCGCTG
GTACGTACCATTGGTGTAAACAAATTCAAAAGTTGTTCTGCTACTATTCAAAACCTGTGCCCATCATCACTTTCAGTA
AAAGCAGATGTCCATCACTTATCAGCAATCATGCATTTGTTACCGGGCACTAAATAATTAGCTGTCACTTTAAGAACCTGCAGACATGATCATGCATATGGCCGGGGTTTGGAATCTAAT
CTAAGTAAAGCCTATGTGATCGATCTGTGTCCCCTAGCTAGCGACCTTTTCTTTTTTATGTGCATGCACATCGCGTGCACCAAATGATGCTGCACTTTCATGATCTGCATCTGCATCAGT
ATAAATAAATCAGAATGTGATTTTTAACTGCATGGTAATTGTGTGCAGACGGGCGGCAACGGGTACCAGGTCCCAGCGGGCCGTCGAGACGGGAGCGTGTCAAAGGCAAGCGACACGAGC
GGCAACCTGCCTCCGCCGACCCCGAGCGTGCCGCAGCTCACGGCGATCTTCGCGTCCAAGGGGCTGACACAGAAGGACATGGTAACACTCTCCGGAGCCCACACCATCGGGGGCTCCCAC
TGCACCTCCTTCAGCAGCCGCCTCCAGACCCCCGGCCCACAGACCCCCGACCCGACCATGGACCCGGGCTACGTGGCCCAGCTAGCCTCGCAGTGCTCATCGTCCTCGTCGGGCATGGTG
CCCATGGACGCCGTGACTCCCAACACCTTCGACGAAGGGTACTTCAAGGGCGTCATGGCCAACCGCGGCCTGCTGGCCTCCGACCAGGCGCTGCTCGGCGACGGGGCCACCGCCGGCCAG
GTGGTCGCCTACGCCAACGACCCGGCCACGTTCCAGAGCGACTTCGCCGCCGCCATGGTCAAGATGGGATACGTCGGCGTGCTCACCGGCAGCAGCGGCAAGATCAGGGCCAACTGCAGG
GTCGTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGCGATGCGGCTGCTCGTCCAAGTGGCGGTCACATCAGCGTTGCTGATGGCGGCGGCGGTGTCGGCGCAGCTGCGGGTGGGGTTCTACGACAGCTCGTGCCCGGCGGCAGAGATC
ATCGTTCAGCAGGAAGTGAGCAGCGCGGTGGCAGCCAACCCGGGCCTCGCCGCCGGCCTCCTCCGGCTGCATTTCCACGACTGCTTCGTGGGAGGCTGCGAGGCGTCGGTGCTGGTGGAC
TCGACGGCGAGCAACACGGCGGAGAAGGACGCCGGGCCGAACAAGAGCCTCCGTGGGTTCGAGGTGATCGACCGGATCAAGGCCCGGGTGGAGCAGGCGTGCTTCGGCGTCGTCTCCTGC
GCCGACATCCTCGCCTTCGCCGCCAGGGACGGCATCGCGCTG
ACGGGCGGCAACGGGTACCAGGTCCCAGCGGGCCGTCGAGACGGGAGCGTGTCAAAGGCAAGCGACACGAGCGGCAAC
CTGCCTCCGCCGACCCCGAGCGTGCCGCAGCTCACGGCGATCTTCGCGTCCAAGGGGCTGACACAGAAGGACATGGTAACACTCTCCGGAGCCCACACCATCGGGGGCTCCCACTGCACC
TCCTTCAGCAGCCGCCTCCAGACCCCCGGCCCACAGACCCCCGACCCGACCATGGACCCGGGCTACGTGGCCCAGCTAGCCTCGCAGTGCTCATCGTCCTCGTCGGGCATGGTGCCCATG
GACGCCGTGACTCCCAACACCTTCGACGAAGGGTACTTCAAGGGCGTCATGGCCAACCGCGGCCTGCTGGCCTCCGACCAGGCGCTGCTCGGCGACGGGGCCACCGCCGGCCAGGTGGTC
GCCTACGCCAACGACCCGGCCACGTTCCAGAGCGACTTCGCCGCCGCCATGGTCAAGATGGGATACGTCGGCGTGCTCACCGGCAGCAGCGGCAAGATCAGGGCCAACTGCAGGGTCGTC
TGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGCGA TGCGGCTGCT CGTCCAAGTG GCGGTCACAT CAGCGTTGCT GATGGCGGCG GCGGTGTCGG CGCAGCTGCG GGTGGGGTTC TACGACAGCT CGTGCCCGGC GGCAGAGATC  ATCGTTCAGC AGGAAGTGAG CAGCGCGGTG GCAGCCAACC CGGGCCTCGC CGCCGGCCTC CTCCGGCTGC ATTTCCACGA CTGCTTCGTG GGAGGCTGCG AGGCGTCGGT GCTGGTGGAC  TCGACGGCGA GCAACACGGC GGAGAAGGAC GCCGGGCCGA ACAAGAGCCT CCGTGGGTTC GAGGTGATCG ACCGGATCAA GGCCCGGGTG GAGCAGGCGT GCTTCGGCGT CGTCTCCTGC  GCCGACATCC TCGCCTTCGC CGCCAGGGAC GGCATCGCGC TGACGGGCGG CAACGGGTAC CAGGTCCCAG CGGGCCGTCG AGACGGGAGC GTGTCAAAGG CAAGCGACAC GAGCGGCAAC  CTGCCTCCGC CGACCCCGAG CGTGCCGCAG CTCACGGCGA TCTTCGCGTC CAAGGGGCTG ACACAGAAGG ACATGGTAAC ACTCTCCGGA GCCCACACCA TCGGGGGCTC CCACTGCACC  TCCTTCAGCA GCCGCCTCCA GACCCCCGGC CCACAGACCC CCGACCCGAC CATGGACCCG GGCTACGTGG CCCAGCTAGC CTCGCAGTGC TCATCGTCCT CGTCGGGCAT GGTGCCCATG  GACGCCGTGA CTCCCAACAC CTTCGACGAA GGGTACTTCA AGGGCGTCAT GGCCAACCGC GGCCTGCTGG CCTCCGACCA GGCGCTGCTC GGCGACGGGG CCACCGCCGG CCAGGTGGTC  GCCTACGCCA ACGACCCGGC CACGTTCCAG AGCGACTTCG CCGCCGCCAT GGTCAAGATG GGATACGTCG GCGTGCTCAC CGGCAGCAGC GGCAAGATCA GGGCCAACTG CAGGGTCGTC  TGATACATGC GATCCATCCT TGATTGCAAA CATATATCAG GCTAGGAACC TCGATCTTTT TTGTCTCAAG TAAATTAAAG AGTGGCGAAT GATGGGTTTT GATTGATTGG TTTGGACTGG  ACGTGGTAGC TTATATAATT CCAGCGTTCT TAATTTCACC ATGTACGTAT TTTTCGCTGC CTATTCTTGA TCGATCTGTA TTGTTGATTC TTTGTTTGTC TTGAGAAAAT TTGTAACTAG  CTCGTGAGTA CTGTTCGTGT GCCAAACTAA TGGTGCTAAA TATATACTCT AATATATAAA GGGCTAATTA TTTTGTAAGA TAGCTAGAAG AGTACTCCCT CCGATCCTAA ACTGTTGTCG 
AAATATCACA TGTATGTAGA CGCTTTTGAA GAATAGATAT ATTCATATTT GGGAAAATTT GAGTC 

Retrieve as FASTA