Entry information : BdiPrx112 (Bradi3g55850)
Entry ID 7922
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx112 (Bradi3g55850)
Name (synonym) BdiPrx112 (Bradi3g55850)
Class Class III peroxidase    [Orthogroup: Prx060]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx112
start..stop
S start..stop
AtaPrx11-1D 537 0 29..377 24..358
TaPrx11-1D 537 0 29..352 24..338
TurPrx11-A 535 0 29..377 24..357
HvPrx123 515 0 29..352 33..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 55938009..55938242 234 N° 2 55937022..55937924 903  
complement(join(55937022..55937924,55938009..55938242))


exon

Literature and cross-references BdiPrx112 (Bradi3g55850)
DNA ref. Phytozome 12:   Bd3 (55938242..55937022)
Protein sequence: BdiPrx112 (Bradi3g55850)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   378 (347)
PWM (Da):   %s   38723.61 (35788.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.13 (6.12) Peptide Signal:   %s   cut: 32 range:32-378
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRSSSSALAGVAGLVLAVLCCSPATMTEAHTQFGAYNKTCPQAEDVVLKEMTAVLAKSPDLAGPLLRLFSVDCLLGGCDGSILLDSTASNTAEKDSPLNKGLRGFDAVDSIKAKLEAACPGVVSCSDVLALAARDAVRLAGGPYVPVPTGREDGNRSSAADVAPNTPPPDATVADLITFFSRLNLTAKDLAVLSGAHTIGKARCPSFSPRLYNFTTTNNGNNNNATSSDPALDANYTAALRGQCKAGGDMAALVDLDPGSAGVFDLGYYRAVAASKGLLSTDAALLLDADTRAYVLRQANATVPDEFFADFAASFVNMSKIGVLTHHKGEIRRLCSAVNPPSKAASSAAPAKSVTAVIARSLMDLGCVFVLVLTVF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 1), no EST. Containing motif 'SVDC'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTAGATCATCATCATCAGCTCTCGCCGGCGTTGCAGGGCTGGTGCTTGCAGTCCTGTGTTGCTCGCCGGCGACGATGACGGAGGCCCACACGCAGTTCGGGGCCTACAACAAG
ACGTGCCCGCAGGCGGAGGACGTGGTGCTCAAGGAGATGACCGCCGTCCTCGCAAAATCCCCCGACCTCGCCGGACCTCTGCTCCGCCTCTTCTCCGTCGACTGCCTGCTCGGG
GTACGA
TAACCAATCCATAAAAAAAAAAACTTAAAACCAAAGTCGTGATCATCAGAGAGCTCACACTCACTCGCTCTCCTGCAGGGCTGCGACGGCTCGATCCTCCTGGACTCGACGGCCAGCAAC
ACGGCGGAGAAGGACTCGCCGTTGAACAAGGGCCTCCGGGGCTTCGACGCCGTGGACTCCATCAAGGCCAAGCTGGAGGCGGCGTGCCCGGGAGTCGTCTCCTGCTCCGACGTGCTGGCC
CTCGCCGCGCGCGACGCCGTGCGGCTGGCCGGGGGGCCCTACGTCCCGGTCCCGACGGGGAGGGAGGACGGCAACCGGTCCTCCGCCGCCGACGTGGCGCCCAACACCCCGCCGCCCGAC
GCCACCGTGGCCGACCTTATAACCTTCTTCTCCAGGCTCAACCTCACCGCCAAGGACCTCGCCGTGCTCTCCGGCGCCCACACCATCGGCAAGGCCCGCTGCCCCTCCTTCTCCCCACGC
CTCTACAACTTCACCACCACCAACAACGGCAATAACAACAATGCTACCTCCTCTGACCCGGCTCTCGACGCCAACTACACGGCGGCTCTCCGCGGGCAGTGCAAGGCCGGCGGTGACATG
GCAGCCCTCGTGGACCTTGATCCCGGCAGCGCTGGCGTGTTCGACCTCGGGTACTACCGGGCCGTGGCGGCGAGCAAGGGGTTGCTGTCCACGGACGCTGCGCTGCTGCTCGATGCTGAC
ACCAGGGCCTACGTGCTCCGGCAGGCCAACGCCACGGTGCCAGACGAGTTCTTTGCTGACTTCGCCGCGTCGTTCGTCAACATGAGCAAGATCGGCGTGCTCACGCACCACAAGGGCGAG
ATAAGGAGACTCTGCTCCGCCGTCAACCCGCCCTCGAAGGCGGCATCTTCGGCGGCGCCGGCGAAGTCCGTGACCGCCGTGATCGCGAGGTCTCTGATGGATTTGGGTTGTGTTTTTGTT
TTGGTTTTGACTGTCTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTAGATCATCATCATCAGCTCTCGCCGGCGTTGCAGGGCTGGTGCTTGCAGTCCTGTGTTGCTCGCCGGCGACGATGACGGAGGCCCACACGCAGTTCGGGGCCTACAACAAG
ACGTGCCCGCAGGCGGAGGACGTGGTGCTCAAGGAGATGACCGCCGTCCTCGCAAAATCCCCCGACCTCGCCGGACCTCTGCTCCGCCTCTTCTCCGTCGACTGCCTGCTCGGG
GGCTGC
GACGGCTCGATCCTCCTGGACTCGACGGCCAGCAACACGGCGGAGAAGGACTCGCCGTTGAACAAGGGCCTCCGGGGCTTCGACGCCGTGGACTCCATCAAGGCCAAGCTGGAGGCGGCG
TGCCCGGGAGTCGTCTCCTGCTCCGACGTGCTGGCCCTCGCCGCGCGCGACGCCGTGCGGCTGGCCGGGGGGCCCTACGTCCCGGTCCCGACGGGGAGGGAGGACGGCAACCGGTCCTCC
GCCGCCGACGTGGCGCCCAACACCCCGCCGCCCGACGCCACCGTGGCCGACCTTATAACCTTCTTCTCCAGGCTCAACCTCACCGCCAAGGACCTCGCCGTGCTCTCCGGCGCCCACACC
ATCGGCAAGGCCCGCTGCCCCTCCTTCTCCCCACGCCTCTACAACTTCACCACCACCAACAACGGCAATAACAACAATGCTACCTCCTCTGACCCGGCTCTCGACGCCAACTACACGGCG
GCTCTCCGCGGGCAGTGCAAGGCCGGCGGTGACATGGCAGCCCTCGTGGACCTTGATCCCGGCAGCGCTGGCGTGTTCGACCTCGGGTACTACCGGGCCGTGGCGGCGAGCAAGGGGTTG
CTGTCCACGGACGCTGCGCTGCTGCTCGATGCTGACACCAGGGCCTACGTGCTCCGGCAGGCCAACGCCACGGTGCCAGACGAGTTCTTTGCTGACTTCGCCGCGTCGTTCGTCAACATG
AGCAAGATCGGCGTGCTCACGCACCACAAGGGCGAGATAAGGAGACTCTGCTCCGCCGTCAACCCGCCCTCGAAGGCGGCATCTTCGGCGGCGCCGGCGAAGTCCGTGACCGCCGTGATC
GCGAGGTCTCTGATGGATTTGGGTTGTGTTTTTGTTTTGGTTTTGACTGTCTTTTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTA GATCATCATC ATCAGCTCTC GCCGGCGTTG CAGGGCTGGT GCTTGCAGTC CTGTGTTGCT CGCCGGCGAC GATGACGGAG GCCCACACGC AGTTCGGGGC CTACAACAAG  ACGTGCCCGC AGGCGGAGGA CGTGGTGCTC AAGGAGATGA CCGCCGTCCT CGCAAAATCC CCCGACCTCG CCGGACCTCT GCTCCGCCTC TTCTCCGTCG ACTGCCTGCT CGGGGGCTGC  GACGGCTCGA TCCTCCTGGA CTCGACGGCC AGCAACACGG CGGAGAAGGA CTCGCCGTTG AACAAGGGCC TCCGGGGCTT CGACGCCGTG GACTCCATCA AGGCCAAGCT GGAGGCGGCG  TGCCCGGGAG TCGTCTCCTG CTCCGACGTG CTGGCCCTCG CCGCGCGCGA CGCCGTGCGG CTGGCCGGGG GGCCCTACGT CCCGGTCCCG ACGGGGAGGG AGGACGGCAA CCGGTCCTCC  GCCGCCGACG TGGCGCCCAA CACCCCGCCG CCCGACGCCA CCGTGGCCGA CCTTATAACC TTCTTCTCCA GGCTCAACCT CACCGCCAAG GACCTCGCCG TGCTCTCCGG CGCCCACACC  ATCGGCAAGG CCCGCTGCCC CTCCTTCTCC CCACGCCTCT ACAACTTCAC CACCACCAAC AACGGCAATA ACAACAATGC TACCTCCTCT GACCCGGCTC TCGACGCCAA CTACACGGCG  GCTCTCCGCG GGCAGTGCAA GGCCGGCGGT GACATGGCAG CCCTCGTGGA CCTTGATCCC GGCAGCGCTG GCGTGTTCGA CCTCGGGTAC TACCGGGCCG TGGCGGCGAG CAAGGGGTTG  CTGTCCACGG ACGCTGCGCT GCTGCTCGAT GCTGACACCA GGGCCTACGT GCTCCGGCAG GCCAACGCCA CGGTGCCAGA CGAGTTCTTT GCTGACTTCG CCGCGTCGTT CGTCAACATG  AGCAAGATCG GCGTGCTCAC GCACCACAAG GGCGAGATAA GGAGACTCTG CTCCGCCGTC AACCCGCCCT CGAAGGCGGC ATCTTCGGCG GCGCCGGCGA AGTCCGTGAC CGCCGTGATC 
GCGAGGTCTC TGATGGATTT GGGTTGTGTT TTTGTTTTGG TTTTGACTGT CTTTTAGTAC TCCTTTAATT GGTTTCCATT GATTTGTAAT TGTAATAATG GAGTATGGA 

Retrieve as FASTA