Entry information : BdiAPx08 (Bradi5g20670)
Entry ID 7925
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-02-08 (Toky Ramarohetra (Scipio))
Peroxidase information: BdiAPx08 (Bradi5g20670)
Name (synonym) BdiAPx08 (Bradi5g20670)
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiAPx08
start..stop
S start..stop
SbAPx09 561 0 11..366 1..351
OsAPx10 557 0 11..366 1..348
ZmAPx10 555 0 11..366 1..351
SiAPx04 549 0 11..366 1..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23467732..23467869 138 N° 2 23467961..23468083 123 N° 3 23468285..23468360 76 N° 4 23468448..23468482 35
N° 5 23468579..23468644 66 N° 6 23468763..23468803 41 N° 7 23468924..23469054 131 N° 8 23469262..23469368 107
N° 9 23469476..23469613 138 N° 10 23469739..23469873 135 N° 11 23469968..23470078 111  
join(23467732..23467869,23467961..23468083,23468285..23468360,23468448..23468482 ,23468579..23468644,23468763..23468803,23468924..23469054,23469262..23469368,234 69476..23469613,23469739..23469873,23469968..23470078)


exon

Literature and cross-references BdiAPx08 (Bradi5g20670)
DNA ref. Phytozome 12:   Bd5 (23467732..23470078)
EST ref. GenBank:   GT832371.1 [3' end]   GT788045.1 [Fragment]
Protein sequence: BdiAPx08 (Bradi5g20670)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366
PWM (Da):   %s   39187.09  
PI (pH):   %s   9.02
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRWSSKGGESMAGATFLSAPALLGPRAGGLPSVSVTSSPARRQHAYIQVCCHAKAGGSEAAAAAREEPPRFRRRDLIGGCMGTAVGLEIIDGSTGVATAADLIERRQRSEFQSSIKGTLTAAIAKPELVPSLLTLALNDAMTYDKATKSGGPNGSIRLSAEINRPENSGLSAALDMLTDAKKEIDSYSKGGPIAFADLIQIAQQALKQTFLDAAIAKTGGNEEKGRTLYSAYGSSGQWGLFDKIFGREDTQEPDPEGRVPKWSSASVQEMKHKFIAVGFGPRLAVMSAFLGPDQAATEAKLIADPDCRPWVEKYQRSRETVSRTDYEVDLITTLTKLSYLGQKINYEAYTYPKQKINLGKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 10 introns), 15 ESTs. Strain="Bd21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCTGGTCGTCCAAGGGAGGAGAATCAATGGCGGGCGCGACCTTTCTCTCCGCTCCCGCGCTGCTTGGCCCCCGCGCCGGCGGCCTCCCTTCCGTCTCAGTCACATCATCCCCGGCG
CGCAGACAGCATGCATAC
GTATGTGCGCGTCCCGATTTCTGCTCGACTTGTGAGTTCAAATTAGACAACGAGAAAAAGGCACCAAGGTTTCTTGACTAACTCCCTGCAGATTCAGGTATG
CTGTCACGCCAAAGCCGGGGGCTCCGAGGCTGCTGCCGCCGCACGCGAAGAGCCTCCGCGGTTCCGCAGAAGAGATTTGATCGGGGGCTGCATGGGCACCGCCGTTGGCTTG
GTACGTGC
TGCTTAGTGACTTTCTTGAGCGTCAATGTTAGGAAATCATCGATGGGTCTACTTTCCTGCATTTCCACGACACAGCCAAGCCAAACAAATGCAGCATGATGGGAGAGAATATTCCACACG
ACACGATTGCACTTCGTTCTTTTGATATTGACCCGGATCAGAGGCGCTAAACTTGCTCTGTGTCTTCGGTTAGGAAATCATCGACGGGTCTACGGGAGTGGCTACCGCGGCCGATCTGAT
TGAACGCAGACAACGCTCTGAGTTCCAAT
GTAGGTTGCCTCAGGTCCTCCTTTTTTTTGTTTTCCCCTTCACATCCTTCTTACCACCATAGCTGATGCCCTTGGTTCTTTCTTCAGCAAG
CATCAAAGGCACCCTCACAGCAGCCATACAG
GTGAGATTGCAAATTATGTACACTGACTCGGTTCGCTATCTCTTCATTCTATCTGTCTCTTTTGTTGACTGATGAAAACTGAAAATTCT
TCTCAAGGCGAAGCCAGAGCTCGTCCCATCTCTGTTGACATTGGCACTGAACGACGCCATGACATATGACAAGGTCTGGTCTATAAATGGCTTACTAAAATCAGTTGTCAATTGCGCCCT
CTATACATGGCATACATGGAACTAACCTATGGTGGCACTGGCTGTTAATTTGACTCTTCTGTGAACTGTAGGCCACAAAGTCAGGAGGGCCAAATGGATCGATCAGGCTAAGGTACTAGC
TAGCAGTTTCTGTCTCTACATCCTTGTGTTGATGTTGCAATTATGCTCTGCAGATGGCAACCTAACAAGTTTTTGACCTTGTTGTTTGATCAATTCCTGTTAAACAATAAAGTGCAGAAA
TAAACAGACCTGAAAACAGTGGGCTTTCTGCTGCTTTGGATATGCTAACTGACGCGAAGAAAGAGATTGATTCCTATTCCAAGGGAGGTCCCATTGCATTTGCAGATCTGATCCAAATAG
CCG
GTACTTAATTACTCCCTCCGTCCAAAAATAAGTGACTTGGATTTGTATAAATTCTTTTACAAACGCACGCCACTTATTTTGGGACTGAGGAAGTACTTAACATTATTTGGTTCACAT
TATTTTTGTGGATCATTACTAACTGGATCTTCTGTAATTTTTTCTATTATTGAATGATAGACTGCTTAAATTTGCTTGTACCCGCAACAGCACAACAGGCGCTCAAGCAAACATTCCTTG
ACGCAGCCATTGCAAAGACCGGTGGGAACGAAGAAAAGGGAAGGACCCTGTACTCTGCATACGGTTCAAGTGGACAG
GTATTCGTTCATTCTCCACGGCCCGAGTCTGTCTGATCATCTT
TATTACATGCATGATTTTACTAATATAAGGTGATATGCATTTTTGTTTGCGTCTATTACCATAGTGGGGTCTTTTCGACAAGATATTCGGGCGCGAGGATACACAAGAACCTGATCCAGA
GGGAAGGGTGCCTAAGTGGAGCAGTGCTTCAGTGCAGGAAATGAAGCATAAGTTCATCGCCGTCGGTTTCGGTCCTCGTCAG
GTCACTACTCATTTTGCTTGATAACCTGTTCTTTCATT
CTTTCTATCACTGTTTTAGCCTTCGGTAGGACTGCAAAAACTGTGGTTCAGTTCAGTCTCACCAATACCATGACAATCCTACTGCAGCTTGCTGTGATGTCAGCATTCTTGGGTCCTGAC
CAAGCCGCCACGGAGGCGAAACTGATAGCTGATCCAGATTGCCGCCCATGGGTCGAGAAGTACCAGCGCAGTCGTGAGACCGTCTCCCGGACTGACTACGAG
GCAAGAAAGATTGAACGA
TTCTGGCAATGCCAATGCTGCAGGACATACAGCTCTGATGTTTAAACTTTTGCTTCTGAACGTATATATCTTGCAGGTTGACCTGATAACCACGCTGACGAAGCTCAGTTACCTCGGCCA
GAAGATAAACTACGAGGCGTACACGTATCCCAAGCAGAAGATTAACCTGGGTAAACTGAAGCTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCTGGTCGTCCAAGGGAGGAGAATCAATGGCGGGCGCGACCTTTCTCTCCGCTCCCGCGCTGCTTGGCCCCCGCGCCGGCGGCCTCCCTTCCGTCTCAGTCACATCATCCCCGGCG
CGCAGACAGCATGCATAC
ATTCAGGTATGCTGTCACGCCAAAGCCGGGGGCTCCGAGGCTGCTGCCGCCGCACGCGAAGAGCCTCCGCGGTTCCGCAGAAGAGATTTGATCGGGGGCTGC
ATGGGCACCGCCGTTGGCTTG
GAAATCATCGACGGGTCTACGGGAGTGGCTACCGCGGCCGATCTGATTGAACGCAGACAACGCTCTGAGTTCCAATCAAGCATCAAAGGCACCCTCACA
GCAGCCATACAG
GCGAAGCCAGAGCTCGTCCCATCTCTGTTGACATTGGCACTGAACGACGCCATGACATATGACAAGGCCACAAAGTCAGGAGGGCCAAATGGATCGATCAGGCTAAGT
GCAGAAATAAACAGACCTGAAAACAGTGGGCTTTCTGCTGCTTTGGATATGCTAACTGACGCGAAGAAAGAGATTGATTCCTATTCCAAGGGAGGTCCCATTGCATTTGCAGATCTGATC
CAAATAGCCG
CACAACAGGCGCTCAAGCAAACATTCCTTGACGCAGCCATTGCAAAGACCGGTGGGAACGAAGAAAAGGGAAGGACCCTGTACTCTGCATACGGTTCAAGTGGACAGTGG
GGTCTTTTCGACAAGATATTCGGGCGCGAGGATACACAAGAACCTGATCCAGAGGGAAGGGTGCCTAAGTGGAGCAGTGCTTCAGTGCAGGAAATGAAGCATAAGTTCATCGCCGTCGGT
TTCGGTCCTCGTCAG
CTTGCTGTGATGTCAGCATTCTTGGGTCCTGACCAAGCCGCCACGGAGGCGAAACTGATAGCTGATCCAGATTGCCGCCCATGGGTCGAGAAGTACCAGCGCAGT
CGTGAGACCGTCTCCCGGACTGACTACGAG
GTTGACCTGATAACCACGCTGACGAAGCTCAGTTACCTCGGCCAGAAGATAAACTACGAGGCGTACACGTATCCCAAGCAGAAGATTAAC
CTGGGTAAACTGAAGCTGTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCTGGT CGTCCAAGGG AGGAGAATCA ATGGCGGGCG CGACCTTTCT CTCCGCTCCC GCGCTGCTTG GCCCCCGCGC CGGCGGCCTC CCTTCCGTCT CAGTCACATC ATCCCCGGCG  CGCAGACAGC ATGCATACAT TCAGGTATGC TGTCACGCCA AAGCCGGGGG CTCCGAGGCT GCTGCCGCCG CACGCGAAGA GCCTCCGCGG TTCCGCAGAA GAGATTTGAT CGGGGGCTGC  ATGGGCACCG CCGTTGGCTT GGAAATCATC GACGGGTCTA CGGGAGTGGC TACCGCGGCC GATCTGATTG AACGCAGACA ACGCTCTGAG TTCCAATCAA GCATCAAAGG CACCCTCACA  GCAGCCATAC AGGCGAAGCC AGAGCTCGTC CCATCTCTGT TGACATTGGC ACTGAACGAC GCCATGACAT ATGACAAGGC CACAAAGTCA GGAGGGCCAA ATGGATCGAT CAGGCTAAGT  GCAGAAATAA ACAGACCTGA AAACAGTGGG CTTTCTGCTG CTTTGGATAT GCTAACTGAC GCGAAGAAAG AGATTGATTC CTATTCCAAG GGAGGTCCCA TTGCATTTGC AGATCTGATC  CAAATAGCCG CACAACAGGC GCTCAAGCAA ACATTCCTTG ACGCAGCCAT TGCAAAGACC GGTGGGAACG AAGAAAAGGG AAGGACCCTG TACTCTGCAT ACGGTTCAAG TGGACAGTGG  GGTCTTTTCG ACAAGATATT CGGGCGCGAG GATACACAAG AACCTGATCC AGAGGGAAGG GTGCCTAAGT GGAGCAGTGC TTCAGTGCAG GAAATGAAGC ATAAGTTCAT CGCCGTCGGT  TTCGGTCCTC GTCAGCTTGC TGTGATGTCA GCATTCTTGG GTCCTGACCA AGCCGCCACG GAGGCGAAAC TGATAGCTGA TCCAGATTGC CGCCCATGGG TCGAGAAGTA CCAGCGCAGT  CGTGAGACCG TCTCCCGGAC TGACTACGAG GTTGACCTGA TAACCACGCT GACGAAGCTC AGTTACCTCG GCCAGAAGAT AAACTACGAG GCGTACACGT ATCCCAAGCA GAAGATTAAC  CTGGGTAAAC TGAAGCTGTG ATGCGATGGA TCACTGCTCT CGGCATGTCT GCTAGCCATT GCCCTTCAAA AGTCGAGGAC TTCACTACAA TATATACGTA TCTACGTGTG GAGAGTGATT  TTGATTTTGC CGGGAGCATT CGTGTTTTCG TTTTGTTGTT TATACGACGA ATCTCTGTAA AGGTAGTTGT TGGAGACGTT CAGCTCTTCG GCTAGCTAGA TGGGTGATTG TGTCTGTAGC 
TTTCCCACTA TTTTGACGCT GATTTTTGGA GAAATAACTC GTGTATTATT CCTATGGACC TAAAAATAGT ACGAGTACTT CTAGTTTAAC TGAGA 

Retrieve as FASTA