Entry information : BdiPrx107 (Bradi3g32110)
Entry ID 7929
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2014-01-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx107 (Bradi3g32110)
Name (synonym) BdiPrx107 (Bradi3g32110)
Class Class III peroxidase    [Orthogroup: Prx188]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx107
start..stop
S start..stop
OsPrx127 425 4e-151 16..319 19..318
SbPrx13 394 1e-138 1..318 3..319
ZmPrx52 381 1e-133 21..318 24..317
SofPrx03 279 3e-93 19..315 22..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34375274..34375492 219 N° 2 34375595..34375763 169 N° 3 34375870..34376058 189 N° 4 34376154..34376536 383
join(34375274..34375492,34375595..34375763,34375870..34376058,34376154..34376536 )


exon

Literature and cross-references BdiPrx107 (Bradi3g32110)
DNA ref. Phytozome 12:   Bd3 (34375274..34376536)
Protein sequence: BdiPrx107 (Bradi3g32110)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (295)
PWM (Da):   %s   34486.33 (32174.1) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.63 (8.73) Peptide Signal:   %s   cut: 25 range:25-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRSSGVVVLVAVVAGMLLCVAEAQTQLKPGYYDQTCKDAEAIVFDEVRKAWNADRSVPAALLRLHFHDCFVNGCDGSVLLESWDRQAEKDAPPNKSLRGYEVIDRAKARLEMACRQTVSCADILAYAARDSVKVATGGFHYAVPGGRPDGTVSRATMANSNLPPPTQRNVDLLAQAFINKGLSKDDLIVLSGAHTLGVTRCGTFDYRLSNSNDKGMDPWFLNSLRAQCNRDASRVVPLDDGSQFAFDTKYYANVIANRGVLESDAALNSPSTVARVRQLRDGTPQTFHGAFAAAMGRMGALRGANPGKVRDHCRRVRT

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 3 introns), no EST. Incorrect prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGCGATCATCAGGAGTAGTAGTGCTGGTCGCCGTGGTGGCGGGGATGCTCCTGTGCGTGGCCGAGGCGCAGACCCAGCTCAAGCCCGGGTACTACGACCAGACCTGCAAGGACGCC
GAGGCCATCGTGTTCGACGAGGTCAGGAAGGCGTGGAACGCCGACCGGTCCGTCCCGGCCGCGCTGCTCCGCCTGCACTTCCACGACTGCTTCGTCAAT
GTATATACACAAAAGCTTTCT
CTCTTCTCCGTTGTTGATCGATCTCCGCATTCATATGCTGACCGGCCACGACGTCTCTGTGGATTACTCGTACGTGTTCAGGGCTGCGACGGGTCGGTGCTGCTAGAGTCCTGGGACAGG
CAGGCGGAGAAAGACGCGCCGCCGAACAAGAGCCTCCGGGGTTACGAAGTCATCGACAGGGCCAAGGCGAGGCTCGAGATGGCGTGCAGGCAGACGGTCTCCTGCGCCGACATCCTCGCC
TACGCCGCCA
GGGACAGCGTCAAGGTCGCGGTACGTTCGTTCGTCCATAAGCCCGACAAAGCGTATGTACACAAACTTCAACTTGCTGTCATCCGATCGCTGACCGCCGCGACCAAAAAT
GAACGGGAATTCGCAGACCGGCGGCTTCCATTACGCCGTCCCCGGCGGGAGGCCGGACGGCACCGTGTCGCGGGCGACCATGGCCAACAGCAACCTCCCACCACCCACCCAGCGCAACGT
CGACCTTCTCGCGCAGGCCTTCATCAACAAGGGCCTCTCCAAGGACGACCTCATCGTCCTCTCAG
GTAACTAATTCACAGTTCTTGCAATTGCAAGAGTTAACACCACGAAGCCGATCTA
CATATCTTTGTTCTGATCTGAACATGAACATATGATGCAGGGGCGCACACGCTGGGGGTGACGCGGTGCGGCACGTTCGACTACAGGCTGAGCAACAGCAACGACAAGGGCATGGACCCG
TGGTTCCTCAACAGCCTGAGGGCGCAGTGCAACCGCGACGCCAGCAGGGTGGTGCCGCTCGACGACGGCAGCCAGTTCGCGTTCGACACCAAGTACTACGCCAACGTAATCGCCAACCGC
GGCGTGCTCGAGTCCGACGCCGCGCTCAACTCGCCGTCCACCGTCGCCAGGGTCAGGCAGCTCCGGGACGGCACCCCGCAGACGTTCCACGGCGCCTTCGCGGCCGCCATGGGGAGGATG
GGCGCGTTGCGCGGCGCCAACCCGGGCAAGGTCCGCGACCACTGCAGGAGGGTCAGGACGTAA

Retrieve as FASTA