Entry information : BdiPrx100 (Bradi3g09130)
Entry ID 7933
Creation 2011-01-19 (Toky Ramarohetra)
Last sequence changes 2011-01-20 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx100 (Bradi3g09130)
Name (synonym) BdiPrx100 (Bradi3g09130)
Class Class III peroxidase     [Orthogroup: Prx018]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx100
start..stop
S start..stop
SiPrx77 426 5e-151 3..323 4..319
HvPrx13 424 1e-150 2..323 5..321
SiPrx82 412 1e-145 2..323 4..321
TmPrx06 409 1e-144 23..323 25..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7229993..7230202 210 N° 2 7230312..7230503 192 N° 3 7230592..7231164 573  
join(7229993..7230202,7230312..7230503,7230592..7231164)


exon

Literature and cross-references BdiPrx100 (Bradi3g09130)
DNA ref. Phytozome 12:   Bd3 (7230029..7231164)
EST ref. GenBank:   DV488700.1 [Fragment]
Protein sequence: BdiPrx100 (Bradi3g09130)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (301)
PWM (Da):   %s   34715.3 (32106.0)  
PI (pH):   %s   7.34 (6.98) Peptide Signal:   %s   cut: 24 range:24-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MESFTGWRCFFLALFLAFSAARGQLSTTFYANTCPGLSQIVRDNMTTAIAKDRRMGASILRLHFHDCFVLGCDASILLDDVGGVVGEKSAIPNVNSVRGYEVIDTIKASVESSCPGVVSCADILTLAARDGTFLLGGPSWDVALGRRDATTPASPNVALQNLPPFFASVGELITAFGNKGLTPRDMTALSGAHTVGSAQCMNFRDHIWKETNIDVSFANLRRSTCPATAPNGDGNLAPFDVQTELVFDNGYYKNLAVRKGLLHSDQELYNGGGPQSQAALVNQYSNNNKLFFDDFVVAMKKMGSIGTLTGNAGQIRRNCRLVNP*

Retrieve as FASTA  
Remarks Incorrect prediction from phytozome. 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCGTTCACAGGCTGGCGTTGCTTCTTCCTTGCGCTTTTCCTCGCCTTCTCTGCCGCCCGCGGGCAGCTCAGCACGACCTTCTACGCCAACACCTGCCCGGGCCTGTCGCAGATC
GTGCGCGACAACATGACCACGGCCATCGCCAAGGACCGCCGCATGGGCGCCTCCATCCTCAGGCTCCACTTCCACGACTGCTTCGTCCTG
GTACAAAATTATCATCGTTCTTTAATTTAT
GGAAGTTTTGGCTCTTCGTCCACCTTGTATATGATCGACTGGCGCGGCTGCACATCATATGTTCTTATTTATGTGCTAGGGTTGCGATGCGTCGATCCTTCTGGATGACGTGGGTGGCGT
CGTGGGCGAGAAGAGCGCCATCCCGAACGTGAACTCCGTCCGCGGCTACGAGGTGATCGACACGATCAAGGCGAGCGTAGAGAGTTCCTGCCCAGGCGTCGTCTCCTGCGCCGACATCCT
CACCCTCGCCGCACGGGACGGAACCTTTCTG
GTACGTGTACAGTATATACATGCACGTACAGAATATCGTCGTGTACATATCAGGGGGCCAAGATTAACAGGAGAGTACATGCATGAAGC
TGGGCGGGCCAAGCTGGGACGTGGCGCTGGGCCGGCGCGACGCGACGACGCCGGCGAGCCCGAACGTGGCGCTCCAGAACCTCCCGCCCTTCTTCGCCAGCGTCGGCGAGCTCATCACGG
CGTTCGGCAACAAGGGCCTGACCCCGCGCGACATGACGGCGCTCTCCGGCGCGCACACCGTGGGATCCGCGCAGTGCATGAACTTCCGCGACCACATCTGGAAGGAAACAAACATCGACG
TGTCGTTCGCAAACCTGCGCAGGAGCACCTGCCCCGCCACGGCGCCCAACGGCGACGGCAACCTGGCGCCCTTCGACGTGCAGACGGAGCTCGTCTTCGACAACGGATACTACAAGAACC
TGGCAGTCAGGAAAGGCCTGCTCCACTCCGACCAGGAGCTCTACAACGGCGGCGGCCCGCAGTCGCAGGCCGCGCTGGTGAACCAGTACAGCAACAACAACAAGCTCTTCTTTGATGACT
TCGTCGTGGCCATGAAGAAGATGGGGAGCATCGGCACGCTCACCGGGAACGCCGGACAGATCAGGCGCAACTGTAGGCTTGTCAACCCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTCGTTCACAGGCTGGCGTTGCTTCTTCCTTGCGCTTTTCCTCGCCTTCTCTGCCGCCCGCGGGCAGCTCAGCACGACCTTCTACGCCAACACCTGCCCGGGCCTGTCGCAGATC
GTGCGCGACAACATGACCACGGCCATCGCCAAGGACCGCCGCATGGGCGCCTCCATCCTCAGGCTCCACTTCCACGACTGCTTCGTCCTG
GGTTGCGATGCGTCGATCCTTCTGGATGAC
GTGGGTGGCGTCGTGGGCGAGAAGAGCGCCATCCCGAACGTGAACTCCGTCCGCGGCTACGAGGTGATCGACACGATCAAGGCGAGCGTAGAGAGTTCCTGCCCAGGCGTCGTCTCCTGC
GCCGACATCCTCACCCTCGCCGCACGGGACGGAACCTTTCTG
CTGGGCGGGCCAAGCTGGGACGTGGCGCTGGGCCGGCGCGACGCGACGACGCCGGCGAGCCCGAACGTGGCGCTCCAG
AACCTCCCGCCCTTCTTCGCCAGCGTCGGCGAGCTCATCACGGCGTTCGGCAACAAGGGCCTGACCCCGCGCGACATGACGGCGCTCTCCGGCGCGCACACCGTGGGATCCGCGCAGTGC
ATGAACTTCCGCGACCACATCTGGAAGGAAACAAACATCGACGTGTCGTTCGCAAACCTGCGCAGGAGCACCTGCCCCGCCACGGCGCCCAACGGCGACGGCAACCTGGCGCCCTTCGAC
GTGCAGACGGAGCTCGTCTTCGACAACGGATACTACAAGAACCTGGCAGTCAGGAAAGGCCTGCTCCACTCCGACCAGGAGCTCTACAACGGCGGCGGCCCGCAGTCGCAGGCCGCGCTG
GTGAACCAGTACAGCAACAACAACAAGCTCTTCTTTGATGACTTCGTCGTGGCCATGAAGAAGATGGGGAGCATCGGCACGCTCACCGGGAACGCCGGACAGATCAGGCGCAACTGTAGG
CTTGTCAACCCCTGA

Retrieve as FASTA