Entry information : BdiPrx13
Entry ID 7934
Creation 2011-01-20 (Toky Ramarohetra)
Last sequence changes 2011-01-20 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx13
Name BdiPrx13
Class Class III peroxidase    [Orthogroup: Prx080]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx13
start..stop
S start..stop
BdiPrx15 412 7e-145 3..330 22..347
BdiPrx14 363 1e-125 6..329 24..346
SbPrx35 340 1e-115 29..329 113..411
BdiPrx39 319 1e-108 24..330 28..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16004833..16005066 234 N° 2 16003674..16004474 801  
complement(join(16003674..16004474,16004833..16005066))


exon

Literature and cross-references BdiPrx13
DNA ref. Phytozome 12:   Bd1 (16004964..16003674)
Protein sequence: BdiPrx13
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344
PWM (Da):   %s   38036.84  
PI (pH):   %s   6.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAARTCEASIRFPYPFLPEWLNPPPSPPAPVLRYDYYKDTECSGVEDTVRRVVAEAEERQPGIGAGLIRLFFHDCFVEGCDASVLLRPTKANPQPEMLGVPNVNSLHGFNVIDDAKKALREKCEGVVSCADILAFAARDATVLLGKVKHFEMPSGRYDGRVSNASYTLYNLPPPFADLRLLKDMFKLKGFNTDEMVTLSGAHSIGVSRCSSFCDRSDNASSNMNPWLASKLRSQCTCNTSSLNAMVNQDNVTPRVLDNQYYWNVINKKVLFKSDAALLSSWETAAEVLVNALYPNKWEEKFAAAMVKMGSIDVKSKDDGEIRKVCGFVNYSTPDREGDVRVADQ*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1). No transcript predicted in Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCACGCACATGCGAAGCCAGCATCAGGTTCCCCTACCCGTTCCTGCCGGAATGGCTCAACCCTCCTCCCTCTCCTCCTGCCCCGGTGCTCAGATACGACTATTACAAGGATACC
GAGTGCTCCGGTGTGGAGGACACCGTGAGGCGCGTCGTGGCGGAGGCGGAGGAGAGGCAGCCCGGCATCGGCGCTGGGCTCATCCGCCTCTTCTTCCATGACTGCTTCGTCGAG
GTACTC
ATTTACATACTCCATCCGTTTCATTTTAACAAACTTTACATATAGCGTAGGTAAGTTTTCGTCGAGGTACTCATTTACATATACCCCATCCATTTAATATGTATTTTACATGGCATGACA
ACTATACAATTTCGAAAAGAATTCTTAAAATGGATTCAATGGAATAATTTTTGTAGCACATAAATTATATTACCGGTCTAATTAATGGTCAAACTTGAACCTCAAAACATGTGCCATCCC
CTTTCCTGAAAGTAGACGGAGGGAATATACTCTTTTTCTTTTTTGCGAATATGAAGGGAGTATAGTATTGATTACGATTTGACACGATGAATTTATTCATTTGTTGATTCAGGGCTGTGA
TGCATCGGTCCTCCTTAGACCGACGAAGGCCAACCCGCAGCCGGAGATGCTCGGCGTCCCCAACGTCAACAGCCTCCACGGCTTCAATGTGATCGACGATGCCAAGAAGGCACTCAGGGA
GAAGTGCGAGGGGGTCGTCTCATGCGCCGACATCTTGGCATTCGCAGCCCGCGATGCCACGGTCCTCCTCGGGAAGGTGAAGCACTTCGAAATGCCATCCGGCCGCTACGATGGGAGGGT
GTCCAATGCTAGCTACACTCTCTACAACCTGCCGCCGCCTTTCGCTGACCTCCGCCTGCTCAAGGACATGTTCAAACTCAAAGGGTTCAACACCGACGAGATGGTCACCCTCTCCGGGGC
CCATAGCATCGGGGTCTCCCGCTGCTCATCCTTCTGTGACCGAAGCGATAACGCCTCCTCGAACATGAACCCCTGGTTAGCCAGCAAGCTGAGGAGCCAGTGCACCTGCAACACCAGCAG
CCTTAACGCCATGGTTAACCAGGACAATGTGACCCCCAGAGTCTTGGACAACCAATACTATTGGAATGTGATCAACAAGAAAGTGTTGTTCAAATCAGACGCCGCGCTCCTGTCGTCCTG
GGAGACTGCGGCGGAGGTGCTCGTCAACGCCCTATACCCTAATAAGTGGGAGGAGAAGTTTGCAGCGGCGATGGTTAAGATGGGCAGCATCGACGTGAAGAGCAAGGACGACGGAGAGAT
TAGGAAGGTGTGCGGGTTCGTCAACTATAGCACTCCTGATCGGGAAGGAGATGTTCGGGTCGCGGATCAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCACGCACATGCGAAGCCAGCATCAGGTTCCCCTACCCGTTCCTGCCGGAATGGCTCAACCCTCCTCCCTCTCCTCCTGCCCCGGTGCTCAGATACGACTATTACAAGGATACC
GAGTGCTCCGGTGTGGAGGACACCGTGAGGCGCGTCGTGGCGGAGGCGGAGGAGAGGCAGCCCGGCATCGGCGCTGGGCTCATCCGCCTCTTCTTCCATGACTGCTTCGTCGAG
GGCTGT
GATGCATCGGTCCTCCTTAGACCGACGAAGGCCAACCCGCAGCCGGAGATGCTCGGCGTCCCCAACGTCAACAGCCTCCACGGCTTCAATGTGATCGACGATGCCAAGAAGGCACTCAGG
GAGAAGTGCGAGGGGGTCGTCTCATGCGCCGACATCTTGGCATTCGCAGCCCGCGATGCCACGGTCCTCCTCGGGAAGGTGAAGCACTTCGAAATGCCATCCGGCCGCTACGATGGGAGG
GTGTCCAATGCTAGCTACACTCTCTACAACCTGCCGCCGCCTTTCGCTGACCTCCGCCTGCTCAAGGACATGTTCAAACTCAAAGGGTTCAACACCGACGAGATGGTCACCCTCTCCGGG
GCCCATAGCATCGGGGTCTCCCGCTGCTCATCCTTCTGTGACCGAAGCGATAACGCCTCCTCGAACATGAACCCCTGGTTAGCCAGCAAGCTGAGGAGCCAGTGCACCTGCAACACCAGC
AGCCTTAACGCCATGGTTAACCAGGACAATGTGACCCCCAGAGTCTTGGACAACCAATACTATTGGAATGTGATCAACAAGAAAGTGTTGTTCAAATCAGACGCCGCGCTCCTGTCGTCC
TGGGAGACTGCGGCGGAGGTGCTCGTCAACGCCCTATACCCTAATAAGTGGGAGGAGAAGTTTGCAGCGGCGATGGTTAAGATGGGCAGCATCGACGTGAAGAGCAAGGACGACGGAGAG
ATTAGGAAGGTGTGCGGGTTCGTCAACTATAGCACTCCTGATCGGGAAGGAGATGTTCGGGTCGCGGATCAGTAA

Retrieve as FASTA