Entry information : PpaPrx54 (Pp3c2_28980V3 [3.3])
Entry ID 7945
Creation 2011-01-27 (Toky Ramarohetra)
Last sequence changes 2012-01-05 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-02 (Achraf Jemmat)
Peroxidase information: PpaPrx54 (Pp3c2_28980V3 [3.3])
Name (synonym) PpaPrx54 (Pp3c2_28980V3 [3.3])
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx54
start..stop
S start..stop
PpaPrx28 659 0 1..326 1..326
MePrx79 296 7e-100 34..325 26..322
GmPrx05 290 9e-98 21..323 10..321
GmPrx170 288 5e-97 21..323 10..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 906921..907166 246 N° 2 907340..907519 180 N° 3 907651..907807 157 N° 4 907926..908323 398
join(906921..907166,907340..907519,907651..907807,907926..908323)


exon

Literature and cross-references PpaPrx54 (Pp3c2_28980V3 [3.3])
DNA ref. Phytozome 12:   chr02 (19536548..19535146)
Protein sequence: PpaPrx54 (Pp3c2_28980V3 [3.3])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326
PWM (Da):   %s   33421.43  
PI (pH):   %s   4.29
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRSTKIGSDSQAPAPWLLTILIASSIAVQHVVHGAVQVGFYDATCSAAESIVKGAVQSAVALDGTIAASIIRLHFHDCFAQGCDASIMLTGTGSERDAPPNLSVRGYGVINDAKAQLESSCPGVVSCADIIALAARDSVEILGGATYGAETGRFDGAAPAASVNIPSPNSAVAEATPFFTNLGLTQDDMVNLLGAHTVGVSQCQFFVDRLYNFQGTGLPDPSLDATYLAVLQSRCPNVAGDVTTVALDQGSESSFDTGYFTNIQASKGVLRIDQEIANDASTSGRVNTLAASPSTFGTDFATSMIAMGRIAVLTSGSVRSDCETA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns). Tandem duplication of PpaPrx28 or misassembly!!)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGAGATCGACGAAAATTGGTAGTGACAGTCAGGCTCCTGCTCCCTGGCTTCTCACCATACTGATCGCTTCTTCGATCGCGGTCCAGCACGTGGTCCACGGGGCCGTCCAGGTGGGG
TTCTACGACGCAACATGCAGCGCTGCTGAATCCATTGTGAAGGGTGCGGTGCAATCGGCTGTCGCCTTGGATGGGACCATCGCTGCCAGTATCATTCGCTTGCACTTCCACGACTGCTTC
GCTCAG
GTACGAGGATCCTGGCACCGGAACCCAGAAATCCATGTGGCGAACTTCACCGCTTCCCGCACACGATGTGTTCCTTGCCGGCTGCATTCAGAAAGAATTGGGGCGCAATCATGG
TGGATTGCCCATTGCTGTGTGTTTGCTAATTGTTCCCAAATTCTGTCGGGCCGCTTCAGGGTTGCGATGCATCCATCATGCTCACCGGAACGGGCTCGGAGCGAGATGCACCGCCGAACC
TATCTGTGAGAGGCTACGGCGTCATCAACGATGCCAAAGCTCAGCTGGAATCCAGTTGCCCAGGAGTGGTTTCCTGTGCCGACATAATCGCCCTTGCTGCGCGAGACTCTGTCGAAATC
G
TAAGCCACCATCGCTCCACAGAATCCGACACTATGAATGTCCGCAGTTGTATCCACATCCACATCCCCTGCTCTTGCCGCGCTTGTAGCTCATTTGCCGACGGCTCATCCCTGCCGATTC
ACTTGCGCAGCTAGGTGGAGCCACGTACGGTGCAGAAACTGGGCGCTTCGATGGCGCTGCTCCCGCCGCAAGTGTGAACATACCGTCCCCGAACTCCGCTGTGGCGGAGGCCACTCCATT
CTTCACCAATCTTGGCCTCACGCAGGACGACATGGTCAACCTTCTTG
GTAATGTTGTCAATCATGATCCCGCCTCCAGCAAATCATTTGCGTGTCTGTCCAGAGCGACCTCGGGCCCTCG
TCGTGGCCAACCTGGGATGCTAAAGTTTGGTTCTGGTGTGGACAGGTGCGCACACCGTCGGCGTCTCGCAGTGCCAGTTTTTCGTCGACCGCTTGTACAACTTCCAGGGCACCGGTTTGC
CCGATCCCAGCCTGGACGCGACGTATTTGGCCGTGCTTCAGTCTCGCTGCCCAAACGTGGCCGGCGACGTGACCACCGTGGCCCTGGACCAAGGTTCCGAGTCGTCCTTCGACACCGGCT
ACTTCACCAACATCCAGGCGAGCAAAGGAGTTCTTCGGATCGACCAGGAGATTGCAAACGACGCCAGCACGAGCGGGAGAGTTAACACCCTCGCTGCCTCCCCGTCCACCTTTGGCACAG
ACTTCGCGACCTCCATGATTGCAATGGGGAGGATCGCCGTGCTCACTTCTGGAAGCGTCCGCTCCGACTGCGAGACAGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGAGATCGACGAAAATTGGTAGTGACAGTCAGGCTCCTGCTCCCTGGCTTCTCACCATACTGATCGCTTCTTCGATCGCGGTCCAGCACGTGGTCCACGGGGCCGTCCAGGTGGGG
TTCTACGACGCAACATGCAGCGCTGCTGAATCCATTGTGAAGGGTGCGGTGCAATCGGCTGTCGCCTTGGATGGGACCATCGCTGCCAGTATCATTCGCTTGCACTTCCACGACTGCTTC
GCTCAG
GGTTGCGATGCATCCATCATGCTCACCGGAACGGGCTCGGAGCGAGATGCACCGCCGAACCTATCTGTGAGAGGCTACGGCGTCATCAACGATGCCAAAGCTCAGCTGGAATCC
AGTTGCCCAGGAGTGGTTTCCTGTGCCGACATAATCGCCCTTGCTGCGCGAGACTCTGTCGAAATC
CTAGGTGGAGCCACGTACGGTGCAGAAACTGGGCGCTTCGATGGCGCTGCTCCC
GCCGCAAGTGTGAACATACCGTCCCCGAACTCCGCTGTGGCGGAGGCCACTCCATTCTTCACCAATCTTGGCCTCACGCAGGACGACATGGTCAACCTTCTTG
GTGCGCACACCGTCGGC
GTCTCGCAGTGCCAGTTTTTCGTCGACCGCTTGTACAACTTCCAGGGCACCGGTTTGCCCGATCCCAGCCTGGACGCGACGTATTTGGCCGTGCTTCAGTCTCGCTGCCCAAACGTGGCC
GGCGACGTGACCACCGTGGCCCTGGACCAAGGTTCCGAGTCGTCCTTCGACACCGGCTACTTCACCAACATCCAGGCGAGCAAAGGAGTTCTTCGGATCGACCAGGAGATTGCAAACGAC
GCCAGCACGAGCGGGAGAGTTAACACCCTCGCTGCCTCCCCGTCCACCTTTGGCACAGACTTCGCGACCTCCATGATTGCAATGGGGAGGATCGCCGTGCTCACTTCTGGAAGCGTCCGC
TCCGACTGCGAGACAGCTTGA

Retrieve as FASTA