Entry information : BdiPrx66 (Bradi2g12210 / BRADI2G12216 / Bradi2g12220)
Entry ID 7948
Creation 2011-01-27 (Toky Ramarohetra)
Last sequence changes 2011-02-15 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx66 (Bradi2g12210 / BRADI2G12216 / Bradi2g12220)
Name (synonym) BdiPrx66 (Bradi2g12210 / BRADI2G12216 / Bradi2g12220)
Class Class III peroxidase    [Orthogroup: Prx072]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx66
start..stop
S start..stop
BdiPrx65 563 0 25..355 24..356
TmPrx08 547 0 1..353 1..354
TaPrx46 543 0 1..353 1..354
HvPrx12 541 0 1..331 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10570312..10570542 231 N° 2 10571976..10572812 837  
join(10570312..10570542,10571976..10572812)


exon

Literature and cross-references BdiPrx66 (Bradi2g12210 / BRADI2G12216 / Bradi2g12220)
DNA ref. Phytozome 11:   Bd2 (10570381..10572812)
Protein sequence: BdiPrx66 (Bradi2g12210 / BRADI2G12216 / Bradi2g12220)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (325)
PWM (Da):   %s   37666.95 (34520.2)  
PI (pH):   %s   5.66 (4.94) Peptide Signal:   %s   cut: 31 range:31-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRSRQLAGLAMLLLPAVLCLQMPAPSRAQLQVGFYNTTCPNAEALVRQAVTAAFANNSGIAAGLIRLHFHDCFVRGCDASVLLTINPGGGTTEKDSPPNNPSLRGFDVIAAAKALVEQSCPRTVSCADILAFAARDSVNLTGTNSFYQVPSGRRDGNISTQDDAINNLPGPNSTADSLITGFARKNLTAEDMVVLSGSHTLGRSHCDAFLFKNRERLASGTVSPAYQALLEALCPPTSGQFTLVTTEIDLSTPVVLDNNYYRLLPLNLGLHFSDDQLVRNGTLNAFVNQFIADETLWKQKFFAAMIKMGNIEPKTGAQGEVRLNCSLVNPASSSSAGVIEMPLPDNDGEVATS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1). Transcript found in ensembl with a larger 5'. Incorrect prediction from Phytozome (Bradi2g12210: exon 1 and Bradi2g12220: exon 4).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCCGCAGCAGGCAGCTGGCTGGCCTAGCGATGCTGCTGCTGCCGGCCGTGCTGTGCCTGCAGATGCCGGCGCCGAGCCGCGCGCAGCTGCAGGTGGGGTTCTACAACACCACC
TGCCCCAACGCCGAGGCGCTCGTCCGGCAGGCCGTCACGGCGGCCTTCGCTAACAACTCCGGCATCGCCGCCGGACTCATCCGCCTCCACTTCCATGACTGCTTCGTCAGG
GTAAGCGCG
CGCAGGCTAATTAATTAAAGCAGCTTCTAGCCCACATAGTTTTGCTTGTTTTAGTACTAGCATATTTACAGGTTATTTGTCCTTTAAAGTCAAACAGACACAAAAACTTTTGTCATGCAG
CAAAACATTTTAATTATGAGTGTCAAATCCATACGGTTATTAAAAAGTTTCCAAGGCATAGCTTTAAATGCATGTGTTCTCGCGATTAACTTCGTCAAGTAATTTAGTTACAAATAGCTG
GGTTAATCTAACTAACCAAGCCGAATCCCTCGTTAAAAAGAGTCCAATAATTAATATGGATCTTCAGCACCGATATTATACTTGTTCAAGAATACATGCTTGGCGCTTTTGAAAACTGAA
AAGGTGAACTCTTATGACCAGCTTACAGTAACAAAAATTAATCCCACAAGTAGAAATGTTACATTTTGAAGAAAAAATCAAATATAACTACAGACACGTGAAGGTAATACACAATTAAAT
ATTTCCACATGATAGGGGAAATATGTATTTATAGATAATTTAACTAAGAAGATAAAAACATCAGTTTTTTTTTTTTGGAAGGATAACGATTTTGAATTGACCAACAAGCTTAAAACGATG
GGGATTGGTGATCGACCGAGGATGTGGCCAGCCGGTGTACTCGTTACAGTAAAAAAAGCCACTATTCAACACACTCTTGTTTGGACCACCTATCAAATCAGGCTATAGCTAGCTTCCCAT
CACACATGACGTGTTACCTTGTTAGTTAGGCAGTTCGCTGCTTTATGTAGACTTCTCAATGAGTTAGACAAACAACAGTCAAATGTTTATAGTAGTACTTGTTTGAAGAGCAGGTATAGG
CGTATAGGTGCTAACTGAAGTATAAGTACTGCTACTACATGTCTACGACATGCGACTACCGACGTGAGTATTAGTGTCGCAGCCGACGTTGTATGCAACGACTAGTCGACCATGATACAC
CTACCATGTTGTCATGACGTACGCAGTAAAGAAATGTCCAATTTAATTTGTCCATGTCCATCCAGCACCTTCCAGGGTAGTTGATAGGGCGGCTAATTTGAAGAAGAAATTAATAGTTTT
TGAACGACCGGGCCACATTAGGTAGCTAGGTTAATATAATAACGAGACGTACGTATGGGTCGAGCGATTAAAGGACATATATTTATGGCTATATCCAAGTTGCCTGCTTAAATCTAAGTT
GACGGATTAGAGCCGTTGCATTAATATTTAGATCTCATTTTACTTTTCTTTTTATCGTTTGTTTCGAACGTTAAATCACAAATCATATCCACGATGAGAAATCAACTTATGTCTAACTAA
AAATTAGACAATTTAGATATAGGAAAACCGTAATCTTATCATGGTGTGCCGATCTGCATGTGTACGCGGTGAATTGAGACGCTACTTGATTTATGTACATCCAGGGCTGCGATGCCTCGG
TGCTTCTGACCATCAACCCGGGCGGCGGCACGACGGAGAAGGACTCCCCGCCCAACAACCCGAGCCTCCGCGGCTTCGACGTCATCGCCGCCGCCAAGGCCCTGGTGGAGCAGAGCTGCC
CGCGCACGGTCTCCTGCGCCGACATCCTGGCCTTCGCGGCTCGTGACAGCGTCAACCTCACGGGCACCAACTCGTTCTACCAGGTCCCCTCCGGCCGCCGCGACGGGAACATCTCGACAC
AGGACGACGCCATAAACAACCTCCCGGGCCCCAACTCGACGGCCGACTCCCTCATCACGGGCTTCGCCAGAAAGAACCTGACCGCCGAGGACATGGTGGTGCTCTCGGGGTCCCACACGC
TGGGCCGCTCCCACTGCGACGCGTTCCTGTTCAAGAACCGCGAGAGGCTGGCGAGCGGCACCGTCAGCCCGGCGTACCAGGCGCTGCTGGAGGCGCTGTGCCCGCCCACCAGTGGCCAGT
TCACGCTGGTCACCACGGAGATCGACCTCAGCACGCCCGTCGTGCTGGACAACAACTACTACAGGCTGCTCCCGCTCAACCTGGGCCTCCACTTCTCTGATGACCAGCTCGTCCGCAACG
GCACGCTCAATGCCTTTGTCAACCAGTTCATCGCCGACGAGACGCTGTGGAAGCAGAAGTTCTTTGCGGCCATGATCAAGATGGGCAACATCGAGCCCAAGACCGGGGCGCAGGGCGAGG
TGCGGCTCAACTGCAGCCTCGTCAACCCGGCCTCGTCTTCCTCCGCCGGGGTGATCGAGATGCCCCTCCCGGACAACGACGGTGAGGTTGCCACCAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCCGCAGCAGGCAGCTGGCTGGCCTAGCGATGCTGCTGCTGCCGGCCGTGCTGTGCCTGCAGATGCCGGCGCCGAGCCGCGCGCAGCTGCAGGTGGGGTTCTACAACACCACC
TGCCCCAACGCCGAGGCGCTCGTCCGGCAGGCCGTCACGGCGGCCTTCGCTAACAACTCCGGCATCGCCGCCGGACTCATCCGCCTCCACTTCCATGACTGCTTCGTCAGG
GGCTGCGAT
GCCTCGGTGCTTCTGACCATCAACCCGGGCGGCGGCACGACGGAGAAGGACTCCCCGCCCAACAACCCGAGCCTCCGCGGCTTCGACGTCATCGCCGCCGCCAAGGCCCTGGTGGAGCAG
AGCTGCCCGCGCACGGTCTCCTGCGCCGACATCCTGGCCTTCGCGGCTCGTGACAGCGTCAACCTCACGGGCACCAACTCGTTCTACCAGGTCCCCTCCGGCCGCCGCGACGGGAACATC
TCGACACAGGACGACGCCATAAACAACCTCCCGGGCCCCAACTCGACGGCCGACTCCCTCATCACGGGCTTCGCCAGAAAGAACCTGACCGCCGAGGACATGGTGGTGCTCTCGGGGTCC
CACACGCTGGGCCGCTCCCACTGCGACGCGTTCCTGTTCAAGAACCGCGAGAGGCTGGCGAGCGGCACCGTCAGCCCGGCGTACCAGGCGCTGCTGGAGGCGCTGTGCCCGCCCACCAGT
GGCCAGTTCACGCTGGTCACCACGGAGATCGACCTCAGCACGCCCGTCGTGCTGGACAACAACTACTACAGGCTGCTCCCGCTCAACCTGGGCCTCCACTTCTCTGATGACCAGCTCGTC
CGCAACGGCACGCTCAATGCCTTTGTCAACCAGTTCATCGCCGACGAGACGCTGTGGAAGCAGAAGTTCTTTGCGGCCATGATCAAGATGGGCAACATCGAGCCCAAGACCGGGGCGCAG
GGCGAGGTGCGGCTCAACTGCAGCCTCGTCAACCCGGCCTCGTCTTCCTCCGCCGGGGTGATCGAGATGCCCCTCCCGGACAACGACGGTGAGGTTGCCACCAGCTGA

Retrieve as FASTA