Entry information : SmPrx23-1_79 (SmPrx23a_79)
Entry ID 7957
Creation 2011-02-01 (Christophe Dunand)
Last sequence changes 2011-02-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-01 (Christophe Dunand)
Peroxidase information: SmPrx23-1_79 (SmPrx23a_79)
Name (synonym) SmPrx23-1_79 (SmPrx23a_79)
Class Class III peroxidase    [Orthogroup: Prx044]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx23-1_79
start..stop
S start..stop
SmPrx23-2_30 681 0 1..328 1..328
VvPrx31 354 7e-123 10..328 11..327
CpapPrx55 352 5e-122 13..328 11..325
PgPrx01 351 2e-121 7..324 8..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 571667..571900 234 N° 2 571983..572171 189 N° 3 572243..572408 166 N° 4 572496..572893 398
join(571667..571900,571983..572171,572243..572408,572496..572893)


exon

Literature and cross-references SmPrx23-1_79 (SmPrx23a_79)
DNA ref. Phytozome 11:   scaffold_79 (571667..572893)
Protein sequence: SmPrx23-1_79 (SmPrx23a_79)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   36149.74 (33509.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.21 (9.21) Peptide Signal:   %s   cut: 25 range:25-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEANFPRLGFIAILLLALVWISTAYQSYHPLKMGYYKCTRKCVNAEAIVKKIVRQYVKRDPTLAASLLRMHFHDCFVMGCDASILLNSTKTSIAERDALPNLSLRGFEVINAAKAALEAACPKTVSCADILSLAARDSVETIYGPSWDVPTGRRDGIISNASDVLLNLPPFFANFTTLKSIFAAKGLNVIDLVALSGGHTIGFSHCAAFDARLYNFTGKGDADPSLDPAYAAHLRTKCKHGDLVTKVPLDDTLTGFDTNYYKFIMQNKGLLQSDAALLETRRSRFLVEQSTKPSIFRPQFARSMTKMGRIEVLVEKQGQIRSRCEFVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCAAACTTCCCAAGGCTTGGATTCATTGCAATACTGCTGCTTGCACTGGTTTGGATTTCAACTGCTTATCAATCATATCATCCTCTCAAGATGGGATACTACAAATGCACAAGA
AAATGTGTCAATGCGGAGGCGATTGTCAAGAAGATTGTGAGGCAATATGTTAAAAGGGATCCAACGCTGGCTGCATCACTCTTGAGAATGCACTTCCATGATTGTTTCGTAATG
GTGAGT
TAACAAAGATTAACAACTTAGTGATTTAGATTCTCTTCCCATGGTTATAACTCAACTCTTTTGATGATTTATGCAGGGATGCGATGCCTCTATTCTACTAAACTCTACCAAGACAAGCAT
TGCCGAGAGAGACGCACTCCCAAACTTGTCACTCAGAGGTTTCGAAGTGATCAATGCTGCAAAGGCTGCACTTGAAGCAGCGTGCCCCAAAACAGTATCTTGTGCTGATATTCTCTCCCT
CGCGGCTAGAGATTCAGTAGAAACG
GTACAGAAGCTTTTTATTTCTTATCTATCTCTCATAGTTTTCTAATAAACTTTTTTGATCCAATCACACAGATCTATGGACCTTCTTGGGACGTT
CCAACTGGCCGGAGAGATGGTATTATCTCCAATGCTTCAGACGTTCTCCTAAATCTTCCACCCTTCTTTGCCAATTTCACAACTCTCAAGTCCATCTTTGCTGCAAAAGGGTTGAATGTA
ATTGACCTTGTGGCACTCTCAG
GTAAGATAAATCTCACCTTCACCAACTTTTCGTTTACATTAGCATCTATACACACCTACACTTCTTAATTCCTCGTTTGACTTGCAGGTGGACACACT
ATTGGCTTTTCTCACTGTGCTGCTTTTGATGCCCGGCTCTACAATTTCACTGGGAAAGGTGATGCAGATCCATCTCTAGATCCTGCCTATGCAGCCCACCTTAGAACCAAGTGCAAGCAT
GGAGATCTTGTCACCAAGGTTCCCCTGGATGACACTCTCACAGGATTTGATACGAACTACTACAAGTTTATCATGCAAAACAAGGGGTTGCTCCAGTCCGATGCTGCACTCCTAGAGACT
CGAAGGTCGAGATTCCTGGTGGAGCAATCTACCAAGCCTTCGATCTTCAGGCCCCAGTTTGCACGATCCATGACTAAGATGGGGCGGATTGAGGTGCTCGTTGAAAAGCAGGGACAGATC
CGCAGTCGGTGTGAGTTTGTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCAAACTTCCCAAGGCTTGGATTCATTGCAATACTGCTGCTTGCACTGGTTTGGATTTCAACTGCTTATCAATCATATCATCCTCTCAAGATGGGATACTACAAATGCACAAGA
AAATGTGTCAATGCGGAGGCGATTGTCAAGAAGATTGTGAGGCAATATGTTAAAAGGGATCCAACGCTGGCTGCATCACTCTTGAGAATGCACTTCCATGATTGTTTCGTAATG
GGATGC
GATGCCTCTATTCTACTAAACTCTACCAAGACAAGCATTGCCGAGAGAGACGCACTCCCAAACTTGTCACTCAGAGGTTTCGAAGTGATCAATGCTGCAAAGGCTGCACTTGAAGCAGCG
TGCCCCAAAACAGTATCTTGTGCTGATATTCTCTCCCTCGCGGCTAGAGATTCAGTAGAAACG
ATCTATGGACCTTCTTGGGACGTTCCAACTGGCCGGAGAGATGGTATTATCTCCAAT
GCTTCAGACGTTCTCCTAAATCTTCCACCCTTCTTTGCCAATTTCACAACTCTCAAGTCCATCTTTGCTGCAAAAGGGTTGAATGTAATTGACCTTGTGGCACTCTCAG
GTGGACACACT
ATTGGCTTTTCTCACTGTGCTGCTTTTGATGCCCGGCTCTACAATTTCACTGGGAAAGGTGATGCAGATCCATCTCTAGATCCTGCCTATGCAGCCCACCTTAGAACCAAGTGCAAGCAT
GGAGATCTTGTCACCAAGGTTCCCCTGGATGACACTCTCACAGGATTTGATACGAACTACTACAAGTTTATCATGCAAAACAAGGGGTTGCTCCAGTCCGATGCTGCACTCCTAGAGACT
CGAAGGTCGAGATTCCTGGTGGAGCAATCTACCAAGCCTTCGATCTTCAGGCCCCAGTTTGCACGATCCATGACTAAGATGGGGCGGATTGAGGTGCTCGTTGAAAAGCAGGGACAGATC
CGCAGTCGGTGTGAGTTTGTCAATTGA

Retrieve as FASTA