Entry information : PpaKat04
Entry ID 7964
Creation 2011-02-02 (Christophe Dunand)
Last sequence changes 2011-02-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-02 (Christophe Dunand)
Peroxidase information: PpaKat04
Name PpaKat04
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue types Gametophore
Protonema
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaKat04
start..stop
S start..stop
PpaKat05 921 0 42..534 21..513
PpaKat03 907 0 57..534 9..486
MpKat02 870 0 1..534 63..601
SmKat03-1_34 773 0 19..534 9..517
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2750918..2751093 176 N° 2 2751205..2751348 144 N° 3 2751476..2751794 319 N° 4 2751908..2752225 318
N° 5 2752349..2752561 213 N° 6 2752762..2752922 161 N° 7 2753056..2753329 274  
join(2750918..2751093,2751205..2751348,2751476..2751794,2751908..2752225,2752349 ..2752561,2752762..2752922,2753056..2753329)


exon

Literature and cross-references PpaKat04
DNA ref. Phytozome 11:   scaffold_3 (2750918..2753329)
Cluster/Prediction ref. UniGene:   Ppa.9433
Protein sequence: PpaKat04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   534
PWM (Da):   %s   60249.67  
PI (pH):   %s   6.83
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPGFLNYVGHTIFRFGGGGDGNGKSGATEDDEPLRLGHSGEPLYTTLGGHPVSDDNNSVTVGESGTLTFEDLHLFEKNAHFNRERIPERVVHAKGAGAHGYFEVTHDVTDLCKAKLFDEVGKKTPVFARFSTVTGESGFPDTARDPRGFALKFYTEEGNWDMVGNNTPVFFVRDALKFPDLIHSQKRNPQTHMKDPNAFWDFLSLVPESLHVLITFSPRGVPDGHRHMHGYGSHTYKWINKEGKAHWVKFHFISDQGIKNLTHERAVELAGINPDYSTEDLFQNIQKGNGPSWTFKVQVMPLEDAASYRYDPFDLTKVWPHKDYPLREVGKLKLDRNPTNHFAEVEQSSFSPAHMVPGIEASPDRVLQARLFAYDDAGRYRLGSNHLQIPINQCPFARVQNYSRDGLMTVTENGGSKPNYYPNSFPDLPRPDASQPDVHPYKHEGGIVSRTPPRKWSMQDDYEQPRALWQTMSKEDQGQTAKNIAGHIQGAQEFIIQRQMGIFKRCDPSLAQKVEEMLEMKRKSQDPYTMVA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns) and 12 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCAGGCTTCTTGAATTATGTTGGACACACAATCTTTCGCTTTGGAGGGGGTGGAGATGGCAATGGTAAAAGTGGGGCAACCGAGGATGACGAGCCTCTCCGCTTAGGCCACAGT
GGAGAGCCATTATACACCACGTTGGGCGGCCACCCTGTTTCCGACGACAATAATAG
GTATTCATTCCCCTCGATCAGTCACGACATATGGCAAGCTCGGGTGTAGAGGTTTATGGAGAGA
TTTATCAAGTTTTTTACTGACAATTTGCTGTTGGCATTGTGTCTCAGTGTCACAGTTGGTGAGAGCGGAACCCTGACGTTTGAAGATCTGCATTTGTTCGAAAAGAATGCGCATTTCAAC
CGCGAGCGCATTCCTGAGCGTGTGGTGCATGCTAAGGGAGCTGGTGCTCACGGTTACTTTGAAGTGACACA
GTACGTAATCAATCAGTCAAATCCATACTGAATCCTGTCAAGCGTATTG
TGGATTGGCAAAGAAGTGGGGGTTGTTTTGAGGAAACCAGAGATGCTGACGAATTGTTTGTTACTGTTTTGTCTCCAGCGACGTGACTGATCTTTGCAAGGCGAAACTCTTTGATGAAGT
GGGTAAGAAGACGCCCGTGTTTGCTCGATTTTCCACCGTGACTGGTGAGAGTGGGTTTCCGGATACTGCCAGGGATCCTCGTGGGTTCGCTCTCAAGTTTTACACCGAGGAAGGTAACTG
GGACATGGTGGGAAACAACACGCCGGTCTTCTTCGTCCGCGACGCCTTGAAGTTTCCCGACCTCATCCACTCCCAGAAGCGTAACCCGCAGACTCACATGAAGGATCCCAATGCATTCTG
GGACTTTCTGAGCCTGGTTCCTGAATCTTTGCACCAG
GTTAGACCTCTCCAATCTGACTCATCCTTCCTCAGCTCCATTGCTCAAGGTCACGAGTTTCATTCTTGCCTCAATTCGATCGA
ATCTGAACGTCTTGAGTTCTGCTTCCATAGGTTTTAATTACTTTCTCGCCGAGGGGGGTTCCCGACGGCCATCGCCACATGCACGGCTATGGCTCTCATACATACAAGTGGATAAACAAG
GAAGGAAAAGCTCACTGGGTCAAGTTTCATTTCATTAGCGATCAAGGCATCAAGAATCTCACTCACGAGCGCGCTGTTGAGCTTGCGGGGATCAATCCAGACTACTCCACAGAGGATCTG
TTCCAGAACATTCAGAAGGGTAATGGCCCATCGTGGACATTCAAAGTGCAAGTCATGCCTCTTGAGGATGCTGCGTCGTACCGATACGACCCGTTTGATTTGACGAAG
GTGTGTAGTAAA
ACATTTTAGTGGCGTTTTTGTGTACAATAACTGCGAGTTCTTGAGAATTTTCGACGGTGTCGCGAGATGTCTGCGTGTCGAATTTGACAAGCAGTTAGTATGTTGGCGCAGGTTTGGCCT
CACAAGGATTACCCACTGCGCGAAGTAGGGAAGTTGAAGCTTGATAGAAATCCAACCAACCACTTCGCTGAGGTCGAGCAATCATCTTTCTCGCCTGCACATATGGTTCCTGGAATTGAA
GCATCACCAGACCGCGTTCTCCAGGCTCGTCTTTTCGCTTACGATGATGCTGGTCGCTATCGCCTGGGCTCAAATCACTTGCAA
GTATGACCTCTTCTGAGTCTATCACTCAAAGACTGA
ACAAAGATTGTTCACATATATTTGCCGTTAGTCTTTTGCCCATCTTTGTAGTAGTTCCATGCCTACTATCCCTGCGTTGACAATAGCGTGCATTTAGAAATTTACAGTTGTTTCCAGCCA
CAGTTTTGGTTGTGACTGAGATTCGTTGCCTCTGCGGCTGACAGATTCCGATCAACCAGTGCCCATTTGCGAGAGTGCAAAACTATTCTCGTGATGGGCTAATGACTGTTACTGAGAACG
GTGGCAGCAAGCCGAACTATTACCCCAACTCATTTCCAGATTTGCCGCGGCCCGATGCTTCTCAGCCTGACGTGCATCCTTACAA
GTAGGTCCTCAAGCCATTTCAGGGTTTGCATTGAT
AAAATTGGAGATTCTTTTCTGCTACTGTTTAGGTTCGTCTTGACAGTTAAAAAAAAATTGTTCGCTTTGTGCTCACGGAATCATCTCTCCATGTGCAGGCATGAAGGAGGAATTGTTTCA
AGAACCCCACCCCGAAAGTGGTCGATGCAGGATGATTATGAGCAACCTCGGGCTCTTTGGCAGACCATGTCTAAGGAAGATCAGGGGCAGACTGCCAAAAACATCGCTGGCCACATACAA
GGGGCTCAAGAGTTTATCATTCAGCGCCAAATGGGTATATTTAAGCGCTGTGACCCTAGCCTTGCTCAAAAAGTGGAAGAAATGCTGGAAATGAAGAGAAAATCTCAAGACCCTTACACC
ATGGTAGCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCAGGCTTCTTGAATTATGTTGGACACACAATCTTTCGCTTTGGAGGGGGTGGAGATGGCAATGGTAAAAGTGGGGCAACCGAGGATGACGAGCCTCTCCGCTTAGGCCACAGT
GGAGAGCCATTATACACCACGTTGGGCGGCCACCCTGTTTCCGACGACAATAATAG
TGTCACAGTTGGTGAGAGCGGAACCCTGACGTTTGAAGATCTGCATTTGTTCGAAAAGAATGCG
CATTTCAACCGCGAGCGCATTCCTGAGCGTGTGGTGCATGCTAAGGGAGCTGGTGCTCACGGTTACTTTGAAGTGACACA
CGACGTGACTGATCTTTGCAAGGCGAAACTCTTTGATGAA
GTGGGTAAGAAGACGCCCGTGTTTGCTCGATTTTCCACCGTGACTGGTGAGAGTGGGTTTCCGGATACTGCCAGGGATCCTCGTGGGTTCGCTCTCAAGTTTTACACCGAGGAAGGTAAC
TGGGACATGGTGGGAAACAACACGCCGGTCTTCTTCGTCCGCGACGCCTTGAAGTTTCCCGACCTCATCCACTCCCAGAAGCGTAACCCGCAGACTCACATGAAGGATCCCAATGCATTC
TGGGACTTTCTGAGCCTGGTTCCTGAATCTTTGCACCAG
GTTTTAATTACTTTCTCGCCGAGGGGGGTTCCCGACGGCCATCGCCACATGCACGGCTATGGCTCTCATACATACAAGTGG
ATAAACAAGGAAGGAAAAGCTCACTGGGTCAAGTTTCATTTCATTAGCGATCAAGGCATCAAGAATCTCACTCACGAGCGCGCTGTTGAGCTTGCGGGGATCAATCCAGACTACTCCACA
GAGGATCTGTTCCAGAACATTCAGAAGGGTAATGGCCCATCGTGGACATTCAAAGTGCAAGTCATGCCTCTTGAGGATGCTGCGTCGTACCGATACGACCCGTTTGATTTGACGAAG
GTT
TGGCCTCACAAGGATTACCCACTGCGCGAAGTAGGGAAGTTGAAGCTTGATAGAAATCCAACCAACCACTTCGCTGAGGTCGAGCAATCATCTTTCTCGCCTGCACATATGGTTCCTGGA
ATTGAAGCATCACCAGACCGCGTTCTCCAGGCTCGTCTTTTCGCTTACGATGATGCTGGTCGCTATCGCCTGGGCTCAAATCACTTGCAA
ATTCCGATCAACCAGTGCCCATTTGCGAGA
GTGCAAAACTATTCTCGTGATGGGCTAATGACTGTTACTGAGAACGGTGGCAGCAAGCCGAACTATTACCCCAACTCATTTCCAGATTTGCCGCGGCCCGATGCTTCTCAGCCTGACGTG
CATCCTTACAA
GCATGAAGGAGGAATTGTTTCAAGAACCCCACCCCGAAAGTGGTCGATGCAGGATGATTATGAGCAACCTCGGGCTCTTTGGCAGACCATGTCTAAGGAAGATCAGGGG
CAGACTGCCAAAAACATCGCTGGCCACATACAAGGGGCTCAAGAGTTTATCATTCAGCGCCAAATGGGTATATTTAAGCGCTGTGACCCTAGCCTTGCTCAAAAAGTGGAAGAAATGCTG
GAAATGAAGAGAAAATCTCAAGACCCTTACACCATGGTAGCGTGA

Retrieve as FASTA