Entry information : PpaKat05
Entry ID 7965
Creation 2011-02-02 (Christophe Dunand)
Last sequence changes 2011-02-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-02 (Christophe Dunand)
Peroxidase information: PpaKat05
Name PpaKat05
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaKat05
start..stop
S start..stop
PpaKat04 922 0 21..513 42..534
PpaKat03 881 0 36..513 9..486
MpKat02 848 0 21..513 109..601
SmKat03-1_34 772 0 8..513 14..517
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 435495..435607 113 N° 2 435177..435320 144 N° 3 434144..434993 850 N° 4 433852..434012 161
N° 5 433430..433703 274  
complement(join(433430..433703,433852..434012,434144..434993,435177..435320,4354 95..435607))


exon

Literature and cross-references PpaKat05
DNA ref. Phytozome 12:   scaffold_223 (435607..433430)
Protein sequence: PpaKat05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   513
PWM (Da):   %s   57948.48  
PI (pH):   %s   6.83
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPPSNQAKSDGVHEGVSKQQPTYTTLAGHPVSDDNNSLTIGESGNTLFEDLHLFEKNAHFNRERIPERVVHAKGAGAHGYFEVTHDVTDICKAAFLSEVGKRTPVLGRWSTVTGESGFPDTARDPRGFSIKFYTEEGNWDMVGNNTPVFFVRDAIKFPDLIHSQKRNPATHMKDPNAFWDFLSLVPESLHQVLITFSPRGVPDGHRHMHGYGSHTYKWVNKEGKAHWVKFHFLSDQGIKNLTHERAVELAGINPDYSTEDLFQNIQNGNGPSWTFKVQVMPLEDAPQYRFDPFDLTKVWSHKDYPLREVGKLKFDRNPTNYFAEVEQASFSPGHFVPGIEASPDRVLQARLFAYDDASRYRLGSNYLIPVNRCPFAKVQTYARDGFMNVSDNGGSNPNYYPNSFEDLPRPDPSQPDVHPYKHDGGVVSRTPPRKWTEQDDYEQPRALWQAMSAQDRGQTAKNIAGHIMGAKEMIIQRQMGVFRKCDESLASKVEEMLAVKRIGQDPYTMVA

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCACCAAGCAACCAGGCCAAGTCTGACGGTGTGCATGAGGGCGTGAGTAAGCAGCAGCCGACGTACACCACCCTTGCCGGCCACCCAGTCTCCGACGACAACAACAGGTAATGC
TTTCTGTTGATGCCAAACATGGAATTTTAAGTTGTTGTCACATTGGAATGCAGTATTCAGGCATCACTAGGTTGCTAGTTAGGTCTTTGAATGTGTGAAGATCAGAAGTTAAACTAGAAT
GCGGATCTATCAGGCAGAGTTCTGACATTCCTTGCGACATTTGGCAGTTTGACAATCGGCGAAAGCGGAAACACGCTCTTCGAAGACCTCCACCTGTTCGAGAAGAATGCTCATTTCAAC
AGGGAGCGCATCCCCGAGCGCGTGGTGCATGCCAAAGGCGCGGGTGCACACGGTTACTTTGAAGTCACTCA
GTATGTTTTACCTCTCTTCCTGTCATTCAGTGCTTCTAACTCTCCACAT
TGGTAATGCCTGGGAGATCATGGCTTAAATAAAGCGTTGGTTTTCTCCACGCATCACAACACAACATACATCGTTTTTTTTTTTTTTTTTTTTTTTTGTTTTTGTTTTGACATTGGTTTT
GTGTTCGCGCGCAGCGATGTCACTGACATCTGCAAAGCTGCATTCTTGAGCGAAGTAGGAAAAAGAACTCCAGTCCTCGGACGCTGGTCCACTGTAACAGGTGAGTCTGGATTCCCCGAC
ACAGCGCGAGACCCCCGTGGGTTTTCAATCAAGTTCTACACGGAGGAAGGTAACTGGGACATGGTTGGGAACAATACACCTGTCTTCTTCGTTCGGGATGCAATCAAGTTTCCCGACCTG
ATCCACTCTCAGAAGCGGAACCCAGCGACGCATATGAAGGATCCAAATGCATTCTGGGATTTCCTCAGCCTGGTTCCAGAGTCACTGCACCAGGTGTTGATCACATTCTCCCCACGCGGT
GTTCCTGACGGCCATCGCCACATGCACGGCTATGGCTCCCACACCTACAAGTGGGTCAACAAGGAAGGCAAAGCGCACTGGGTGAAGTTCCATTTCCTAAGCGACCAAGGCATCAAGAAC
CTGACGCACGAGCGCGCAGTTGAGCTTGCAGGTATCAATCCTGACTACTCCACCGAGGATTTGTTCCAAAACATCCAAAACGGCAATGGCCCTTCCTGGACATTCAAGGTGCAAGTCATG
CCTCTCGAGGACGCTCCCCAGTACCGATTTGATCCTTTCGATTTGACGAAAGTGTGGTCACACAAGGATTACCCACTGCGCGAGGTCGGGAAGCTGAAATTTGACAGGAACCCCACAAAT
TACTTCGCCGAAGTGGAACAAGCGTCGTTCTCGCCCGGACATTTCGTACCCGGGATTGAAGCATCGCCAGACCGTGTGCTTCAAGCTCGTCTCTTCGCTTACGATGACGCCAGCCGATAT
CGTCTAGGCTCAAATTACTTGCAG
GTCCTCGTGTGCCTTATTCTCCAAACATTATCCATCCCCCATTCCTGTCGTCCAATTCCTCATCAATCTGGTACAGTATCATTTCTACCAAAAATG
TCGTCTAACTTTCATTCCACCATTCTCTGCAACAGATTCCTGTCAACCGGTGCCCCTTCGCTAAAGTCCAAACCTACGCTCGCGATGGATTCATGAACGTCAGTGACAACGGCGGCAGCA
ACCCAAACTATTACCCCAACTCCTTCGAGGATTTGCCTCGCCCCGACCCTTCTCAACCTGACGTGCACCCTTACAA
GTGATTCAACTCACCCTCACACACACATACGCATATATCAACAA
TGTCTTAGACAACGGCTTCCACAATATTTCAAACGATGGGCGCATTCTTCATCTTCCTGGTTTTGTTACTAATGAGCCTTTACACCCTGTTCGATGAAACGCAGGCACGACGGCGGAGTG
GTGAGTAGAACACCGCCCAGGAAGTGGACGGAGCAAGACGACTATGAGCAGCCAAGAGCTCTATGGCAAGCTATGTCGGCCCAGGATCGGGGGCAGACAGCGAAGAACATCGCGGGCCAC
ATCATGGGCGCCAAGGAGATGATCATCCAGCGACAAATGGGTGTGTTCCGCAAGTGCGATGAGTCCCTGGCAAGCAAGGTCGAAGAGATGTTGGCTGTGAAGCGGATAGGCCAAGACCCT
TACACCATGGTTGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCCACCAAGCAACCAGGCCAAGTCTGACGGTGTGCATGAGGGCGTGAGTAAGCAGCAGCCGACGTACACCACCCTTGCCGGCCACCCAGTCTCCGACGACAACAACAGTTTGACA
ATCGGCGAAAGCGGAAACACGCTCTTCGAAGACCTCCACCTGTTCGAGAAGAATGCTCATTTCAACAGGGAGCGCATCCCCGAGCGCGTGGTGCATGCCAAAGGCGCGGGTGCACACGGT
TACTTTGAAGTCACTCA
CGATGTCACTGACATCTGCAAAGCTGCATTCTTGAGCGAAGTAGGAAAAAGAACTCCAGTCCTCGGACGCTGGTCCACTGTAACAGGTGAGTCTGGATTCCCC
GACACAGCGCGAGACCCCCGTGGGTTTTCAATCAAGTTCTACACGGAGGAAGGTAACTGGGACATGGTTGGGAACAATACACCTGTCTTCTTCGTTCGGGATGCAATCAAGTTTCCCGAC
CTGATCCACTCTCAGAAGCGGAACCCAGCGACGCATATGAAGGATCCAAATGCATTCTGGGATTTCCTCAGCCTGGTTCCAGAGTCACTGCACCAGGTGTTGATCACATTCTCCCCACGC
GGTGTTCCTGACGGCCATCGCCACATGCACGGCTATGGCTCCCACACCTACAAGTGGGTCAACAAGGAAGGCAAAGCGCACTGGGTGAAGTTCCATTTCCTAAGCGACCAAGGCATCAAG
AACCTGACGCACGAGCGCGCAGTTGAGCTTGCAGGTATCAATCCTGACTACTCCACCGAGGATTTGTTCCAAAACATCCAAAACGGCAATGGCCCTTCCTGGACATTCAAGGTGCAAGTC
ATGCCTCTCGAGGACGCTCCCCAGTACCGATTTGATCCTTTCGATTTGACGAAAGTGTGGTCACACAAGGATTACCCACTGCGCGAGGTCGGGAAGCTGAAATTTGACAGGAACCCCACA
AATTACTTCGCCGAAGTGGAACAAGCGTCGTTCTCGCCCGGACATTTCGTACCCGGGATTGAAGCATCGCCAGACCGTGTGCTTCAAGCTCGTCTCTTCGCTTACGATGACGCCAGCCGA
TATCGTCTAGGCTCAAATTACTTGCAG
ATTCCTGTCAACCGGTGCCCCTTCGCTAAAGTCCAAACCTACGCTCGCGATGGATTCATGAACGTCAGTGACAACGGCGGCAGCAACCCAAAC
TATTACCCCAACTCCTTCGAGGATTTGCCTCGCCCCGACCCTTCTCAACCTGACGTGCACCCTTACAA
GCACGACGGCGGAGTGGTGAGTAGAACACCGCCCAGGAAGTGGACGGAGCAA
GACGACTATGAGCAGCCAAGAGCTCTATGGCAAGCTATGTCGGCCCAGGATCGGGGGCAGACAGCGAAGAACATCGCGGGCCACATCATGGGCGCCAAGGAGATGATCATCCAGCGACAA
ATGGGTGTGTTCCGCAAGTGCGATGAGTCCCTGGCAAGCAAGGTCGAAGAGATGTTGGCTGTGAAGCGGATAGGCCAAGACCCTTACACCATGGTTGCTTAG

Retrieve as FASTA