Entry information : GgaPOX03 (TPO-like)
Entry ID 7969
Creation 2011-02-02 (Christophe Dunand)
Last sequence changes 2011-02-03 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-08-12 (Christophe Dunand)
Peroxidase information: GgaPOX03 (TPO-like)
Name (synonym) GgaPOX03 (TPO-like)
Class Non mammalian vertebrate peroxidase    [Orthogroup: POX001]
Taxonomy Eukaryota Metazoa Chordata Aves Phasianidae Gallus
Organism Gallus gallus    [TaxId: 9031 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GgaPOX03
start..stop
S start..stop
OanTPO 1221 0 27..844 69..887
MdoTPO 1203 0 24..844 37..866
HsTPO01 1170 0 1..846 1..847
GgoTPO 1160 0 1..844 1..843
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..94 94 N° 2 1742..1826 85 N° 3 6686..6855 170 N° 4 9094..9226 133
N° 5 13516..13645 130 N° 6 16212..16418 207 N° 7 22645..23160 516 N° 8 30127..30385 259
N° 9 30897..31067 171 N° 10 32521..32758 238 N° 11 34997..35205 209 N° 12 35719..35889 171
N° 13 39917..40077 161  
join(1..94,1742..1826,6686..6855,9094..9226,13516..13645,16212..16418,22645..231 60,30127..30385,30897..31067,32521..32758,34997..35205,35719..35889,39917..40077 )


exon

Literature and cross-references GgaPOX03 (TPO-like)
Literature Beck V., Roelens S.A., Grommen S.V., Schepens P., Darras V.M. Exposure to PCB 77 inhibits TPO gene expression during the final stages of chicken embryonic development.
Protein ref. UniProtKB:   Q2WBI1 [Fragment]
DNA ref. GenBank:   NW_001471671.1 (34697366..34737442)
mRNA ref. GenBank:   AM167549.1
Protein sequence: GgaPOX03 (TPO-like)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   848
PWM (Da):   %s   95086.11 Transmb domain:   %s   i3-25o
PI (pH):   %s   5.37
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKVFIVLGISAAIAFTAVFFSFLQTGKDVLFEASEDNCITEAIQKAVNLVDYATQYALERNIQDKGIASPTSLLAFSKFPEQDSQDISQAAERMEMSIQVLKQRVCQKYKRSLHPDLLSADLLTMIANISGCLPYMLPPKCPNNCLANKYRLITGACNNREHTRWGASNTALARWLPPAYEDGLSQPRGWDPSVRYDGVLLPVREVTRKIINASNEAVTEDNLYSDIIMVWGQYIDHDISFTPQSISRTSFLTGKECQMTCERQNPCFPIKVTTNDALSKGMDCLPFYRSSPACGTGDHSILFGNLSALNPRQQINGLTSFIDASTVYGSTSTVENKLRNLTSEEGLLRVNSKHNDNGQEYLPFTDRVPSPCAQDSNASEDERIECFMAGDSRSSEVTSLTAMHTLWLREHNRLARALKAINSHWSAETVYQEARKIVGALHQIITLRDYIPKIIGPDAFNQYIGLYKGYDPTVNPTVSNVFATAAFRFGHATIQPIVRRLNAQYLDDPELPNLHLHEVFFSPWRLIKEGGLDPLIRGLLAHPAKLQVQGQLMNEELTDKLFVLSNNGSLDLASLNLQRGRDHGLPGYNDWREFCDLPRLETQTDLNTIITNQKVTEKIMELYHIPSNIDVWLGGLVEDFLPGARTGPLFACLIGKQMKALRDGDRFWWENDNVFTDAQKHELKKHSLSRVICDNTGISDVPIDAFQLGKFPQDFKHCSNIDGMNLEAWQETFQEEMCGTPKHVENGNFVYCSEFGESTVTYSCQHGFLLQGEEQLICTNKGWNFQAPVCIDINECEKEINPPCSPTAKCINTKGSYKCFCTEPYKLAEDGRTCIDSIREPAVH

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3). No EST. Sequence from Ensembl ENSGALG00000016370. There exist some discrepancies between NCBI and Ensembl genomic sequences
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGTGTTCATTGTTTTGGGAATTTCAGCAGCTATAGCCTTCACAGCTGTTTTCTTCTCTTTCCTTCAGACAGGCAAAGATGTCCTCTTCGGTAAGTAACAGATAAAACACATATCA
TTTTATTTTGTCAAGCAATTTAGTTTAATCTTTTCTTTTCTTTCTTTCTTTCTTCTTTTTTTTTTTTTTATAATGTGCAAAATACTCTATCTGACTTCCATGAGAATTATTCCATGAGCA
CTTTCTTTCCAAATGCAGCTTCATCACTTGACAAGGGATTACACAGCACATGCAGTGTATCTCAGTTATGTAAGTATGTATGTCTAGGAGTGATTTAATTTTTTAGTGGCATCCATATGT
TTACTGTAATGTTTAGAAGCATGATTGCTGGATTTCTCTACCAGAGTGATAGTTGCTACCTTTACTCACTCTGGACTACAGTCAGTTGCCATGTGATGTGCCAGGTGGCACGCTGCTGCT
GTCCCATAAGGCTGTACATCTCCATGGATCTGTTCCCATTAGGACCCTCTGGTTACTGGAGGGATTTTAGAGCATCTCAGGCTGCAGAAGCACCTACATTCAAATGATAGAATCCCATAT
TTTTAAATACCAGAGCTATTTATTTGACATCTGATCAATCTAAATCAGTGAGGTGTGGTAGACTAGTGCAATAGATACAAAATTGAATTTTGAAAGGATAATTTTTGAGAGGCTGATTTT
ACATTAAAGTGGAGTAGAGATTGTGAAGAAACAGGATTTTTCAATATTTACGTTTCTTTAATTGATTCTATGACTGTTAGATATGGTTTGGAAGGGAAATTTCTTAGGAATTGTTTCTTC
TGAAGTTATTGTAGAATCACAGATAAAATAAAATGATATCCAGACTATAAAATAAATAACCCCTGAATTGATATTCAAGACTACTTTAGATAGTAACTAGATTTTGGACCATCACTGTGA
AGCAGGATCAGATTGATTTTTCTAAAGCAGATTCTCTATTTAATTCTCCCATATTAATTACTGGTAAATATATAGTTTAAAATGAGGTTATATTTTAAGTTAGTTAACACAAAATGAATA
TATGAATAAATGAAAGAGAATGAGAGAGAGTGGAATTCAGGTATAGAAGATGGATCTGCTCTTCTAGATTACAGTCTAAATCAATATTACACTATAAAAAATACTTTAAGCAAAATATAT
TTCTCAAAGGCAAAACCCTTAAAGATAATTAAAAATCTTGCAATATTAAATTCTAAAAGTCTGTGTTAACTATAAAAATCAATCTCTGTTTTTAATTTAGGTGTAAAAACATTTTCAGGC
GTAACTAATCAGAATAACATTAAATGAATCATATGAATGGCTTCTGGTACCTGTGATGGGAGCTCAGACTTGTCCTTTCAGTCCAAGGACAGCCTTATGCAACATACACATGAAGCCTAC
AGAACATAATCCTCACACAACGCCACATTTTCAGATGAACCTATAAGTGTGGTACTACACAGTGTGTATAGCTGGATTTATGCTGGAAGAAAACGAAGGAAAGCTTAACACTTCATATGT
TATGGAAGAATTGATTTACTACTCTTACCTTATTTTTCAGAAAGATCAGAAAACACAGCACTGAATAACAGAGATATGTTGAATGGAGAATAATTGCATAGGAAAATATTGCAAACCTAT
TTATATTACAAATGTATTTCAAAAAATATCTCTTTTTTTATTGTTTTGTTTTTCTTTTGAGAAGCAAGTGAAGATAACTGCATTACTGAGGCAATCCAGAAGGCTGTTAATTTGGTGGAT
TATGCTACACAATATGCTCTGGAAAG
GTAAAAAATAAAATAAAAAGTAAAAAGTGAATTTATTCTGCAAAAGGCTTTCCTAATAGAAGCTTGATAAAAATGAAACTATATACTCACCCCA
GATAAATCACTGGGTCACTGGGCTTTTTAACTTCCCTCAAAATACTGGATATGTGGATATATGGACTATGAAGCATGGCATTATTCAAGGTTCCTATCACAGAAGTTCCTTTAAAAGCCT
TTATAATAGTAGCAGAGTCACATACTGGCTGAGGTTGGCATCTAGCACAGCTCCTGCTCCAGTGGGGACACCCAGAGCAGTGTGCCGCACCAGCACCACATCCATCTCCAAGGAGACCCT
GCAGCCTCTGGGCAGCCTGTGCTGGTGCTCCATCACCATGCAGCACAGAAGTGCTCCTGGCGCTCAGACAGAACCTCTCATCCTCCAGTTTGTGCCCATTGCCTCTCATCCTGGCACTGG
GTACCAATGAAAAGAACCTGGCTCCGTTCTATTTTCATTCTCCTTACTGGTACTTACAGACCCCCTTTGAGCCACCTGTTCTCCAGGCTGAGGAGTCCCAGCTCTCTCGGCCTTTCCTCA
TAGGAAGGATGCTCCAGTAATAATTACAAATATATTGAGAAATAAATATTACAGAAAAGGCCAACAAATAAGATTTTTTTCCCTTCTCCTACTCTCCTCCCTCCCTTTACCCCCTCCTCC
TTTTCCTTCTCTCTCTCCTTTCTTTCCCTTTCCTGTTCAACAGCAGCACTTGAAAATTAGATCAGTAATCCAAAGCTGTTAAATTAAGCATTTGATCCAACAGGAATTGTCTTTAATCTT
TGGATCTTTCTTGGGCAAAACATTGCTAGTAAAAGCAATGTGTGAGCTGTTTATGTCTTTTGCAGTTTGGATTTAACCCTGTAAGCAGCCACAGGGCCAAAGGCTTGCACTGTCAGCAGA
GCATCCAAAGATGTGTATTAGTATCAGCACTAAAGCACATGCTTTCATGTTTTCTGCAATCAGAGGCACAAGTGTCCTGTGCCAGTGTTAGAAACCTGATGTCCATGAGAATATAATTTG
CTCTTGTGTTAACTGGTGTGGAATAGTAGGACTGTTAAAAATGAACATTGCCAGAAGCGAAAACTATTTCTGCTTCGTGCTCTTTCAGTTCCTTGTGGATTTAATCAGCTCATTGAGAGA
CTTCTTGCTGTTTTAATCCAGGCTGGTGTACATGCTCAACACCTGCCTCTTAGATATGAGTCTTTGGCAATTTGCAAAGTACCGAGGACTAAACTATCATCTAATCTCATTATCTTGAGG
AGGGAATGTGTTTAACTCCTTAAATTATATAATTCTGTATCATTGTATCATATTAATCTAAAACTGCTAGGGCTTTTTTCCTTTGTAACAAAGAATGCTATATACTTGAATTAAAGCTTT
AGTCAACACAAAGGCTAAAAACAAGAAAGAAGTGCATATGACTGCACATTTTCAATTCTGGAAGTTATGGAGGTTGCAGCACTGTGAAAACTCATTTTACTTTGGCTTACAAATAATTGA
AGGAAACCACAGTGCAATACAGATGAGCTCGGTGCTACCTTTGAGACTGAAAAGGCAGTTCTGAGATAAAAAGGCAGTATCTTTTTCAGGTTAGAATGGGAAAACTCTTAATCATTCCAC
GTACAGTAGTCCAACCCGATGTTTGCTGAATTCCTGATCTAGAGGTCTGAGCTACAAGCTGTCTGAGTCAAAATAACTGTTTTTTTTTTTCCTCAGACCTCATTTTAACCTTGAATTGTG
ATTGAACTGGACAAATATGTTTCCTTACATCAGGTGTTTAATCACTTAAATTCCTGAACTATTCTTTCCTTACCACGTCTCAGCAATTTCAAAGTATCTGAATTGTAAAACCCCCAACTT
AATATGTTTTATTGTATTTGGTCCCTATCTATGCCAACTCAAATTGGCTATCTATGAGACTATATACGTAATGAATTGCAAAATCATTTTCAATGTTCTGAATCCATTGTTATAATTACA
GTTGCAGAAACCCACTTGGCATCATATTTCAGTCACCCTGGTCATACAGCAACAGTAGCCATGTACATACATATTTTGAGAACGAAGAAAAGATACTCCCTTTATATTCTGCACCGTGCT
GCCTTTACAGGAGATCAGAACAGCAGCAAATGTCTAAGGCATTTGTTCTGACTTGCAATCTCTAAAAAAAAATTACTTTATAAATACATTAATTGAAGACAGAAAGAAATCTCAGAAACA
GAATATCAGACGCTGGATGATGATGTATAGCATGTACTTTGGAGAATGTGTTTTGTGTAGATAGATATACATATATTTTAATATTGATCTGCAATGAGACTCAGTAACTGAGCATCTGGC
AAATATAAACTATCTTCCTCCCAGATATCTCTCATCTTCCAAATAATAATATCACAGGTTGTTGTCTTAGTTTCATGGGGCTATTTCTTTATTACAAATTAATACAATTTTTTTTTTTTT
AATTAGTGACAAAAAACAGCATCTCCTTCCAGAATCAGAGCTCATCTCTGGGAGCATGAGTATGAACTAGAAGAGACTAGAATGGATACATTGAATTAGGAGGTGAAAAGAGGGGAGGAA
ACACAAGTTTGACAAACTAATAACCACTGTGATGATCTTACACAATTCATAAGATTAGAAACAAGGTTGAAGAAAATGTATGGGACGTACCTTGTCCATAAGGGTGGTTTGTTTTGTGTT
TTGTTCTAGCTAATTTTTACAGAGGTTGTCATGTAACTCCCTGATACAGAAATGTTTACTTGGTCATGCATATTTCTTTTTACATGATGTATGACCAATATTTTCCTCAAGTGAGTATGA
AATACTAAACCCCAGTTCTTGCATTTGGTTATGGCATCTTCTAACTTACTAGATGTTTCAGGACTTTTAATACTCCAGCAGAATTCCTAATTGTATATCAAAAACTCAAAGTATACTGCT
GAGGAGCAGGATAGCTCAGTGTCATAGTTAGAAGTGTTCTCAAGTTCTTTTCCTGAAATGACAGGAAGAGTTTCTGTGTAAAGGATAATTGAGAAGGCTAAGACTCTTGTATCAATTAAG
GACACATTCAATATCTAGAAAAGCCTTTGAAGTCACTTGACTCCCGCCCAGTAGGCATTCATAAGCATTGATAAGATCCCCTCTCAGTCTTCTCTTCTTCAGTCTGGACGGTCCCAGGTC
CCTCAGCCTTTCTTCATAAGGGAGATGCTTCAGGCCTCTAATACTCTTTGTGTCCCTCCACTTGTTTCTCTCTAGAAATTCCCTGTCTTTCTTGAACTGGGGAGCCCAGAAGTAGACACA
GTACCCCAGATGTGGTGTCACCAAGGCAGAGTAGAGGGTGAGGATCACCTCTCTTGACCTGCTGACCACTCTTTATAACTTACCCCAGGATACCATTGGCCTTCTTGGCCACAAGGGCAC
ACTGCTGACTCATGGTCATCCTGTGGTCCACCAGGACACCCAGGTCCTTCCCCACAGGAGAAGGATCCTTCTCTTTTCTAGCATATCAACCTCCAGACTGTACTGAGGCATGAGGTTATT
TGTCCCCACATGTAGGACACTGCACTTGTACTTGTTGAACCCCTTAATGTTCACCCCCGTCTCTAAGCTCTCCAATCAGTCCAGGTCACACTGAATGGCAGCATAGCCTTCTGGTGTGTC
AGCCACTCCTCCCAGCTTCATATCATCAGCAAACTTGCTGAGGGTGCATTCTATGCCTTCAGAGATAGAAGGACATGAGTTTGCTGGAATGAGTCCAGAGGAGTGACACGATGATCAGAG
AGCTGGAATAATTTTCTTATGTAGTGAGGCTGAGAGAGAGAGGGTTAGTCAACCTGTAGAAGAGAAGGTTCTGCAGAGACCTCATTGTGGCTTAGTAGTGCCTAAGAGATGCTGGATACT
GGATAGTGACTTTTTACATGAGCATATAGTGCTAGGACAGGTGGTAAGGGCTTTAAAATGAAAGAAGGTAGATTTAAATTAGATATAAGGAATAAATTCTTCACTCTGAGAGTGATGAGG
CACTGGAGCATGTTGCCAGGAGAAGTTGAGGATGCCCCATCACTGGAAGTGTTCAAGGCCCATTTGGATGGGATTTTGAGCAACTTGGTCTAGGGGAAGGTGTCCCATCGGCATGGAGTT
TGGAACTAGGTAATATTTAAAGTTCCTTCCAACCATTCTATGATTCTGTGATTCTTTTTTTCTTATGTTTAAGTTGAAAAGATGTTGTCTAATCAAACTGCTTAAAGGTTAGATCAGACT
GGTTAAGTAACATATTGCCATGTAACTGTGTAATTAACTCCTGCTAAACTAAATGCCGAAACTCCATCTACAGCTAATAAGGCAAGTGTTTGGACCATCTCTGAGAGGAAATGTTTCTAA
TTGTCAGCTGCAGACAGCATCTAGACAACTGTGATTGTTTCCCTGGTGACAGGGGAAGTCATGAATCTGTTTGTAATGACTGAGGTGGTCAGTAATATTAAATGTTATATAAAAATGAAG
CCTACTCACTTAGATGTCTCAACAGGGAGACTTCTATACTGTGATTATTCTGCATGAGCCTTCTCAGCTACTTTGTGCTGCAGACTTTGTCCACCATATCAGTTTCTGTTTCATCCTGAC
AGCTTCACACAAACTTTAACACTGTTATGTGTGCTCAACAGAAGGGCCCTTTCCAGAGTTTTCCTTGCAAAGCAAAGTAAAAATGTATTTTTCATTTTTGCTTTCCCAGTACATCCTTTG
ATTCAAGTTATACCTCAAACTTAGAATATACCCAACATAGACAAGTACACTTATTAACGAGTTTATTGTTTTATTTTTATTATAGAAATATCCAAGATAAGGGAATAGCAAGTCCTACCT
CACTGCTGGCCTTCTCAAAATTTCCTGAACAAGACAGTCAAGATATTTCCCAAGCAGCGGAACGAATGGAAATGTCAATTCAAGTGTTGAAACAAAGAGTTTGCCAGAAGTACAAGCGTT
CTTTGCATCCAACTG
GTAAACACATCAGTAAAACTCCCTGTTGATTTCTTGAATATTGTCTTTTAGATTAAAGTTGTACTATCTTTGCTTATTTTTTACTTCAGGCAGATATACATATCT
TACCGACATCCTGGGGCCAGGATGCTCTCCCTGTTCTTCTTAAAAGCACCCCATGTAGTCACTGTTTTACATTTTTCTTTACTGAAGAGTTGAGGAGACTAGTACTTTGCTATTGGCATC
CTGTGAACTCATGACCATATTGTCTATAAATAGTTTTGCATATTCACATTGTTACAAACTTCTTGTTTATAGTGAAATATTTTTGGGTTTAGTGCTTCTGAGACAAAGACCTTACAAGCA
AAATAATACAGTTCCTATCACTCTCTGACACTGGCACTTTGAACTATATATTACCTCTGGAAATAGATGGTCTTACTGATAGCTTATTTTAAGAAAATATTTTCATATCTCCAAAATTAA
TTTAATAATATATTGCAGTTGCAAATTTGCTTTCACTTCATTATTATTTCAACTGTTTTTTATGTTAGATGGAGAAATAAACAGAGGTAATCAAGAAAGTTCAGTGATGTGTAATTATCC
AAGTAAAGTAAAGTTCTTGTTGCTGTTCAGGATTAATTTCAAGATGAGTCCCTGGTGTCAGGAAAGCCAAAAATTCAGATTTTTTTTTTTCCTTCAAAATATAATTCCTTCACTTAAAGT
AAGCTAGAGATTTATAATCTGTATTCTCTATCTTGAAATTATACCATGACAATATTTTTCAAGATGCCAAGGCATTAGAGTGTTGTAGACAAACACAAAAATCTACAGTTATCTTTTTTT
TTCTTTTTTTTTTTCCTCAAGGAAACATCTGGCTTACTAAATGAATGGGACTTTTGTAGAACTATAAATATTTCTATTTGTGTATGTGTATATTTGTATTTTCACAGACTCACAGAGATA
CAGTGATCTTCTGACTGGTACAGTTTCAAAAGAACTAGAATTTTTAAGTCACAAAGTGTACAAAACTCATAAATTTACAGAACTAAAGCCATTTGCACAGAAGTTGGATAGACTCAATGC
ATTTTATTTGCCACGTCAAAGGGTAGTTTTCTGTGAAACAAAGAACAAAATGTTTTAAAGCAAACATATGAATCAATGCCTAAGAAATACTGATGGTGGGAATAGGATTCTGAGCATGAC
TTTGAACCTGAACTAATATGTGAATGCATCTGTACCCACTGTTTTAACATGGGTAGCTAGGACATAGTAGAAACATTATATATCTGGTGAAACAACCCATTCTCTCTCCGCCCTCACCAC
TACCTTGCACAGATTCTAGTTGCTCAGTGGAACATTTTTCAGCTGATTTGACTCTTGACTCTTTTCTCTTTATTTGTTTGTTTGTTTCTGACTTACATTTTTTCACTTGATTAATGGACT
AAATCAGTTTAGTTCATGGTTGGATGAGAAAAACAGAAAAGTGACCCACAGCAGGCAGCGAGGAGGCAGGGGCAATAGTCACTGCTTCTACCATTTTGTTTTGTCTCATGAGGGTTACAG
TCAGTTTGAAAGGTAGGAGTTTAAGGAAGAATGCTGCTCTTCCTTCATTTGCACCTTTAATGTATCTGCCCTTCATGTATCTATATATATGTGTGTGTGTGAGAGAGGTTGCCAGCTCAC
AGAGTAATATGAATTTATTACATATTACATACATATTACAAAGTAATATGAATGCAGCCTGTTTTTCCCTAGCCCTCAATTTCTGGGCAGTGATTCTATTCTTCTCCCACTCTGCATGTA
GGTATATAGTCAGCTATCCCAACTTTAATAGGATACTTTCAATATCCTTCCTGTCCCAAGAATTTGTTCATTAGTATATACATCTGCTCCTGAACAATATTTTTTATACCTTTGTTTTAA
GTATAAGGACTTGCCAAATGATGTGACCACAATGCATGGAAAGAGAAGAGAATGCAGAGAGGAGAAGATTAAAGAAGAGAAAGGAGCAGGTCCTCCTCAGTTCTCCGCTATGGATGGATG
GCTTTGCTTTTATTCTCTACTCATGAGATAATAAAAATAGCTCTTCCGCTTCACTTTATATCTCCTCTAAGTCCCTAAGACTATCTACTGCAGCACATCTAACTAATGCTCTTTCCCAGA
AAGAAATGCAAATGCTGTAATTGCTGCTGACAATAATGTCTTTTCTCCCATAGAAGCCATATGTCAACAGAATACTTGGGTTCTTCCTTACAGATCTTTTATCAGCTGATCTGCTTACTA
TGATTGCTAACATTTCTGGATGTCTGCCTTATATGTTGCCACCAAAATGTCCAAACAATTGCTTAGCTAATAAGTATCGACTTATCACTGGTGCCTGCAATAACAG
GTATGTATGTTAAG
GATTATGCCCTGAAAAATCTTTCCTCTTTCTTTGTTCCTTTCTTTATTCTTTCCTTTCTTCCTTTCTTTCTTTCTCTTTCTTTAAACTCAATAATTTACCTTTATTTTTCCTAGAAAAAC
TGGGTGGATGAGTTCAATCATTTGACATCAGTGTCTCTCTAAATGAGGTGCCTCTTAAAGATCCCAGGGGTAGAGACTCTTCATCTCAAATTTTCTACACTAATATTTGCAGAGAGGCTC
TCCCTTTCAAAGCTTCTAAGATTACGTAAGAAGCTTTAAATATAGGGTGGACTTATTCAGTAGATGTCTTTTTCTATATAAATTAAACAGATTAAATTCTAACCCAGCTTCCATCTTCCA
TTAAATTAGAACAATATTGAACAGAAAAGAATTACTTCTTCACAACGAGCAATAAGAAAATCAAGTAGATTCTCATTTTTTTTTATTCTCTCACAACCTTAATACTAAGTGAACATGCAC
ATAAAAATTCTAGGTGATATATTTAGTTTTATATATCTATTTTTATGAATGTACTGATTGACTATCTGAATGTCTATTGTTTACTTATTATCTACTTTTACCCTAATATAAGTCAGGATT
ATTTCCTACAAAACTCACCTTAACATATATGACTATATTTTCATAATACTTCAATACAATGAGGATGTAAAATGGAGAATAAGAGACCTTTCAAGTATAAGGACAAATGGTATTTATACT
TAGCCTCAGGTTACCTGGGCTTAAGGTCACAAATGGAAAGGCAGGCTGCAATCATACGCTACTGCAGAGCTGTAAATGGAAGACCATTAGCATTACACAGGTTAAGGCATTCTGCAATAC
GGTGACTGAGCAGTGGTAACATTCTGCAGTTTTATTATTCAATCACTCAGTTTTAATGAGATGAATCAGTATTTCTGCATCACAAGTCATTTGTAAGGAATGTGCATGTTAAGCTCTTTG
TTGAAAGGACACAACCCAATATGCATCAATGTTATAAATCTATCTGGATATACGTGAATTCCCCCAGGCACTTTCAGAATTGCTTGGAATCTGAACTAATAGTTAGTATAATATTTGTAC
TGACAACTCTGTTGGAGCTTGAAAATATTGGCCAAGCAGCCAAATATAAGCACACAGATGAAGCTTCTCATATTCAGGCATTGTTGCTGAGGTCTTTCTCTTCATTTCTGGAGAGAATAA
CAGTTGTGGGTAAATTAAAACATCTTTTTCTCTGTGGTAACTAGTAATACAAGGATGTTTATAGAGGTTTCTAAAATTGGCTGGACTAACTATGATCCATTGGGTTTGGTTAGTCTTTAG
TTGCTGTTTCTACTTTGTATATTTGTATGCTTGTAGTTTTTAAACTATTTAAACCAGTGTTTAAACTATTTACACTCTTCACTTAAAACTTCCGTAGAAGGTGCAAGGTAAAAAAACAAA
CAACAACAACAAAAAAAAAACATAGACTTTGAAACCATCAGGTTAGATCTTAGTCTAAAACTTGGTGAATATCTTGAAATACCTCAAGCTTTACTGAAGTACATCAGCTGAAAAGGTTCG
TTTTACTGTTATGTAAACAACAAATTTTATAATGTACGCTAACTTAAAACTTCAAACATTAACAAAAAGTACTCGTCTATAGTTTTCAATGTTTTACAGCTGCAATTACAAGTGGAAAGC
ATTTAATTATATTAATGATTTTAGTTACCCAGTAGGAATGTACAACTATGCTTTAGGTCAGGAAATCTTGCATTTCTTAGGTAGCATTTAAAAACAAAATTCACAGTGAAATTAATTGGC
CTGTAAGAAAAAAACAAGCAAACAAAACAAAACTGGTTACATATATTTAAAAGTGAGCATGGAACTTCTTAACAGATTCTTTGCTTAATCAGTTTGCATATTTGGGACAAATCAGCACAA
TTACAAAATATTTATTCTCCTAGCACAGAGTTTATTTTTGCATGAAATTCGTAGAACAAAGGCATAACAGAACAGCATGAGCATGGCTTTCTTTGGAGAATATTGTCATGACATCAAACA
TTCCCAGCAGTATCATTATCCTCATTCACTAGTAACACATATCAACAAATTTTACTTTTTTGTATGTCTGAAGGCTTACGTGTGAATAATAAGCAAAATAAATGTACAATAATAATTAAG
AGAACTGGAAGCTAAGGTACTCCCAAGTTGGTTTCATCTGTTTGTTTGTTCATTTTTATCCCAACTAACTCCATTGATCTGTGTTTTTGGTTTTTTTTGTTTTTTTTTTTTAATGTTTAG
GGCAATGAAAATGATCCAAAGGTAGATAAATTACAGGTACTAAAAGAAAGGCATCTTATGGTGCAAATTAAGGTCCTCTAATCTTACCTTTCTGAGGTATTGATATGTCTACTGCAAGAT
TGTGTCTTCAGTTGTTCCTAATAGTAAGAGATAGTACAGGATGACAGGATGGCACTCATGAGGTGTCTCTTTTTCAGGGTTGATGCCAGGAGTTTAGATGACTATATTAATTTTTTTTAT
GCTTGCTATTTGAGCATCTAGGAGGAAATTTATCTGTCAGATTTTTGTTTCATTTTTGTGCCTTTAATAGTTTTATCGAGCAAGAACCTGATGGTTAGTTTGAAGCTCTAATACTATAAG
AGTTATAGGTTTGAATATGGTACACCAATATTCATGGTGTAGGGTATAGGTAGACCAATATGCAGAATAGGGTAAAGAATGATGAATCCTGATTGAATCCACTGACTATGAAAAGAAATT
GAGATGTTTCCTTTAGAATGGCTGCTTCACTTAAATAGAAGCTAGATGTCATTCAAAAGACGTAAATCTGGATAGTGAGCAGTATCTTAAAATTCCAGTTTCCTCCTAAGGGAGTAAAAA
CAATATCCCGATAGTGTAATTCTACTGTTTCACAAGTGAAGGAAAAGTTCCACTTTCCATAAACAGAATGTATCATTATCAAATTTGACTACTATGTAAGCGTGTAATGATACCAAATTC
TCATTATTTCATCTACCCTAGATAAAATATTTATTACTCATGCAAAATTCCAAGACATTAACATGTTTAATAGAATAATAACAAGGCATCTGAGAGGGGTTTTACTAAAGTAGCATTCCA
GTGAGCTGCTACAATATAAAAGCAATCAGGAGAAAAATCACTAGTTAAGCTGCAAAATTAACATTTCATTATTTTTAATTGAGTGAAATAGCACTACACTATGTACAGTATTTTGTGCAA
TTTCAATAAAGACAAATCAACTGTAACTAATTTGAATGCTTTATTGAAACATACTTCAACTTTCAAATGTGAATTATTGTGGATAATTAAGTGCATTACTCTATCATATTACTTGGCAAA
TTGAGTCATATCAGTGTGCTAGAGATCAATGAAGGATTAATTAAGTGCTCCCTCTTTAGTACCTAATAGAAATATAAATGTTATAACATGCTATATTTCTACTAACAGTCAGAGATTACT
GCATACATTTCTAAAACTGTATTTCTTCTTGTTAATATCTTATATATATAACAATTATAAGATTTATTGCACAGATCATGTAAAGCAAATCGACAAACAATAAAAAAACACCTGAAACAT
TCTCCACCTAGAGAAAATGCAATAGAAGTTTTCATGGTAGTAGGAAAACTAACTGGGACAAGCCCAGGACTCAATGACTGAACTAATAAATAAAAAGACCATGAATAATTTCATGAGTAT
TTAATCAAGGATGACCTTACTGCTGTCTACATTCTTTTGCACTTAAACTCTTGTCCTACCTTCTTTCAAAAAGGCTGACTGCAGCATGGAAAACTGGTCTGCGCTAATCCCAAGGTGTGT
GCAGCCAGGTGTTGATTGGAGAAATGCTGCATCATGCTAACAACTAAATGCATACCAGAGCTTAGGCTTGTTCATAAGCCTTCCCAAAAAATAGGTGCAACCAAAAGGAGCTCTGCCACT
GAATCCAACAGCTTAAGCCATCATTCTCCTTTCATTCTTCTTCCTTCATAGATCTTGTTAAATGATCACCTCTGTATGACAAGTACCCATTTTTTCTTTTAAGCTTTCATGAGTCTGATA
GCATCCCTTCTTGTTAAATTGATGTTGGCGTACGTGAAGACCAATAATTGATTCCTTTGCCAAGATCATTATATGAACATCTTGTTACAAGGAATTATTGTCCTGTGGCTGACAATTATT
TTATATTCAGAATTATTCAGAGTTGAAGGTTCTTTGTGCACTATTTTTCTTTGTTTTTCTTCTTTTTTTTCCCAGGGAGCATACTAGATGGGGAGCATCCAACACAGCCTTGGCTAGATG
GCTCCCACCAGCCTATGAAGATGGACTCAGTCAACCTCGAGGATGGGATCCCAGCGTTCGATACGATGGAGTCCTGCTACCCCTG
GTTAGAAAGTATACCATGTGAAACACTGGCTATAA
ACATATCTGCCACAAAAAGCCTAAATTTACATCAAGAAATCAAACAGCAAAAGAACCTGGACCATAGAAAGAGCAGGCAGGACTCCCTTCAGTTGCAGGGCAACCAGTAGACACGGGGTT
GTTATTGCTCAGCCTTGAGAAAAGGAGTCTTAGGGTAGACCTAGACACAGTCTTCTCATGCTGAAAAGGCCATTACAGAAAGAGGAAAGTACTGTCTTCACAGTGATGCACACTGACAAA
GCAAGAGCCAACTACAAGTTGCTCCATATTTTTTCTTGATATAAGAAAAATGCTTTGCTGTGAGGACAATTAAATGCTACAGTAAACTAACTGGACTACCTCTGGAGTACCCCTCATGGG
AAATATCTAAGAGCCAAGAGCTTTATGCTCTTGGAGCTCTAACTAACCTATTTCCTTCTTGTAACAGAAAGTTGCACCACTTGGTCTCCAGAATTTTGTTCTAATGTAAATATGCTGATG
ATTTTATGACTCCTTATTCAGGAAAGGAAGACGAGAATGGCTGTTAACTGAATAAATATAATGCATATACAACATGTGCAATCTATATGTATTATATGTGTACAAATACAAAATGTTGCC
ACCTTGATTAACATACCTTAGTTGAAAAATATTACTATGAAACCAGATTTTTTTTTTTTTAGAAAGTTCAATTTACTAAGCTAAGAAGTCTTTGCAGTATTTACAAATCTTTGCAGCCCA
TGTGCTTAGAAAATAGCAGGGAGGAAAGTCTGAACAAAAAGTATCTGCATAGGGGAATGAGTGAAAAATTCCCCATTGCAGTGTACAATGATTTGAGCTAGACTTACTATTCCTGATTTG
TCATCATTTCTCAAAACCTGACTTTTAATGGGCTCAAGGTCTTTTTATTTTAACCACCACATGTTTAATCAGGATGAAGAAGAGAATTTAGTGTTAATGTCACCTGCAACTCATGTTATT
AATTAAATAACGTGATCTCTAAGCTACATAATTTAGTGCTTGGAGAGGAAAATCTGACATTTGCATAAGTAAATTTCCAGGCTTTACAAACTGCCTGTTTTTAGATTCATTAGAGTACAT
ACTTGTGAAGTAAAACACACTTAAAAAACCTTACATGGTTTCACAGAATTTGATCATATCTGACAACCAGAAAGCTTCTGTGTTTTAATTTGAAGATATGATAAAACTAGTGCCATAACT
GTTTTTCCCCATTTACATTATTTCATCTTTTTTTTTTTACTATTGACTAACTACTCATAATCTATAAAAAGAAACAAGTAAATAAAATGAATGCAAGGTATAAGTCCAACCTGCAGATGT
TCAAGGCCGGGTTGGCTGATGCAGCCTGATCTGGTGATTGGCAACTCTGCCCATGGCAGGGAGTGGGAGCTCAAAGATCTTTAAGATCTCTTCCAACCTAAGCCATTTTATGATTCTTTG
AAGGTTGAGGATTATTGCAAAGTGATGGAACAGAACATAGTTGAGAAATTTAACTCCAATTAGTTTTGAGTTTTTGAATTAGAAAACAAGTTTGAGACCTGTGACCATCAAAGTTATTCA
AATACTGATATAAGGACTTGTATTTCTGATGAGTGTCATGTATCTCTACCCTCGACTATTTCAGTATAAACACTGGTGTTCTTAGCAAGTCCCACATTGCCTCTTGTCCTCACCAATTCT
ATTTAACTGCATCTGCCTTATGCATTCATTATATAACCCCCATATTTATTACAGAATTTTACTCTACTTTATGTGCTGCCCTTTCAATTGCTTGACTCCTAATTGATGGAATGTTTTGCT
GCATGACGGAGGAATTTGTGAATAATATCAATATCCTAATCATATCAAACTGCTGATTTTGCTCCAGATGGCTTCAGTTCAAGTCAATGTCAGCTGAGCATGTACCATTGATATATCCAT
GTGTTCCCTCTAAGAGCATCTGTATCTCCATGCAGTTTTCACAGAAGTGATTTAGGAAATACCTTGAGGCTTCTCCCTGCCTGGAATAATGAAGTAGAGTTTCCAGCTACCATGTATATG
CTACCATGCCTGTCTTCTGGGCTGCATAAGATGCTCTCTTAATGCAGAATAGCCCAGAACCACTGCGTATCCGTGCTGATCTGAGGTTGCTCAGCAGAATCCATTTCTTAAAGGAAGAAA
ACAGAAAAAATTAGAAAGAAAACATAGGAATATAAAAAAGCACAAGGTTTGAAAAATTTTCTGGGAAGGAACAGATGAAAGATACACAGCTCATTTGGCAAAAAAAAAGAAAAACTTAAC
TGAAGCATCTCAGATCTCCATTGGGCACCAGTGTTTCAGCTCCTGAACAGAAGTAGTGCTGTCAGATTTTTTTTTTTTTTTTTTTTTTCCTTCAAGCAAGCCATTGAAAGTACTCTACAC
TATGAAATATTGCAAGGAGGGGTTGTGGGAGGAGATAGCTTTTATTACTGTTCATCCTGATTGTAGTGTTTTATCAGATTGTGTGTAGTAAGTACAACTTGACACTCAAGGTAAATTAGT
TCTTTTCCTAGGTTCGAGAGGTGACAAGAAAGATAATTAACGCATCTAATGAGGCTGTCACCGAAGACAACCTATATTCTGACATCATTATGGTGTGGGGACAATACATAGACCATGACA
TTTCATTCACACCTCAGAGCATAAGTAGAACCAGCTTTTTAACAGGAAAGGAGTGCCAGATGACATGTGAAAGACAAAATCCATGCTTTCCGATAAAG
GTAAGATTTTAAATGAATTTCT
TCCAGACAAATTCCAGGCTCTTGACAGGTGAGTAATGTAAAATACATTAGAGATATACATATGCTAAAATAATTGCAAGGGAAATGAATAGATCATCAATAACACAACAGATGATGATAG
AAATATTTATATCTAGTATATAAATATATCTATCTATCTATCTGATATCTAATATATCATCTTATAACATGAAACAGGTATGGATTTAAATTGCTTTACAGAGATAACAAACTACAGCTA
CAGTACTTAGTACAAATATATTTTTCTACTTCTCAAGTTGATGTTGCAAAGAAACCTTATGTCTCTCCCAGTGTTATTGTTTTCATGCAGCAGAATTCTGAATTCTATCATAGAAAATAA
AGAAAGAGATAATAAATCTGTTTTTTTAAATTGCCAGCCAGGTAAAGTGAAAGGATTTTACCTTCACTCAGTGCAAGCAGCAGCTAATGCAAACTTTTGCAGAAAGATATCTTTTCAATG
TGCATATACAACAATCTCCAAGGAGTTGCTGAAACTTACATACTTCACATCTTTGCTTTGTATAGATCGAAAATTTGAATTCAAAGCTTGTTAGGGAATTAGAAGGAACATTAATTGGTA
TAAATATAGAATTTTATCTTGTCAATTAATTTGAAAGTGCAGGCATACATTTTTTGTTTCTCAAAACACAGACCTTTACTTTATTCTGCAGGGGGGACTCATGCTCATCATAACCCTTGG
ACTGATGCATGAATTTGTGTTCAGAGCAATGTAAATTACTTTTCATTGGGCTGGAGCTTAATTACTGATCATCTTCTTTATGCACTGAAGTTTGCATAGGGTGCAAGTTCCATCAGAGTA
GAAAGCACATAACAGAAAGTAACTGATGAGTGTACCAGAGTCTCCTTTTGATTTAAGTGCCTCATTCCACTTCAATTTAACACAAAGAAAAATATTTTTCTGACTGTAATGAGAACTGAA
TTAGGCCCTGTGTTGAAAGGTGGCTCATCTTCCAGTCGGTGAGATAATCCCTAAGGAATGCTAAGTGATATTAATGACTGCCTGCATTTTTACCACAGTCAGGTAAATTTATTCTCTCTT
AGAGATTTGGACTATTCAAAGTGAGCAGTCATAGCTTGAAAGTGTTCAGAAAGAACACAGACATCTTAGGGAATCAAACTCTCAGATCATATCTTAAGTATTTAATGTATGAGTGACTGG
TTAACCTGATTTAGCCACAATGACAAAAATATACCAGTTTCTATCTGCCTCAAATTTCCATCTTTTGGCTAGGACGTGATTTCCTGTCTTTATGCTCTTAATTAATAGTCATATAAATAT
TCCCATTCCTTCATTAAATGGGACAGAAAGCCCATCCCTGATAAGCAGTGCTTCACATGACCCGATGAAGGAGGTAGAGGTTGATTCCACCATATGACAGAATAAGGTTATGTAATGTAT
CCCATTTTTAAAATACGGTTTGCTTACTATGCCATAGATACAAAACTGCAGAAATCTTTGAATGACTATGATTCTTGTTTTAATACATGACGTGTACAACCAGTACTGATCTTTAACTTC
AAAAAGCCCTCATTCTCATGTGAAAGTAAAAGCCCTCATACTCAAAAGAAGTAATTAGTAATTAGACTTTTAAATTGAGAACAGGCTCATACTGTTGTTCATACTTTGAATCAAACATGA
ATCACAGGAACCAAGGGAATCTAGTCATTGACTTCTGACTAGTTTAAGCTGCCTAGAAATCCCACCAGCTCAAAGAGGAAGCAGTTTAAGGGATCTTCTGCAAAGGACTCCTAAGCTACC
CGTGCATCAGAAGCATTGCAATATAAGAAAAAGTTGTAAATGAAGGCTATAAGTCCTGTTTCTATCTTGATGTTGTGAAGAGCTTAATCACTGAGTGTGTTTCAACTTGCTGTGAAGACA
AATTACATGTATGTGTCCTAAATTTAGCTTTGAATCTGGCCCAGGAGCTGCTCTTGCTCAGTATTATATAGCGTAGCAGAGAAGTGGAGTCATGACAGAACTCATATGACCTTTGGGGTT
CAGTGTCTGATAGCCAGAATGGCCATGGGAAAGAAAAATAAAGAAATTCAGATGCAGTCCTGTTTTAGATAAGTTTCTTGACTCGTGGATTCATTACTTTAGTATAGTTCCATTAATTTT
CAGCCTTATTTTGTCCCACTGTTATTCACAGCTTAAAGAGGGACATATATGAAGATAGTGGTTCTTTTCCTTTTAATATATATATCTAGTATTTTGTGACTACTTTTGTCAAATCTTCAG
TAAAGCTAACATCTACCTGTCAAATATTTGGAAAACAGCCATGGTTAGTATCATACATTCATTTTTTATATGAAGACACTGCAGCTGGTTTCCAAAGGTATTGAAACTGATAATGTATTA
TCCAACAGTGAAAACGTAGAGGCTGCTGTTTGCACTCTTGCTGTGTACCTAAAACAGCTGCACCCAAGGGAAAATTAAAACACACGAGAGGACAAATGTGTTCAGCCATATGGCTGCTCC
AGGGCTTTCACTTGGGAAAGGCAGCTCTTGGCTGTGCAGGTTAGGAAAGATGCCTGGAAAATGTTACAAGACAGTGCAGTTCAAAGACAGATTGAAATATGTGAAAGTGCATTAATATTA
ATGACAAGTGTAGGTAAATTATTTATAGGTTTGCAGGAAACATTATGATTTCCTGTTCTGGACATTTCATAATAAAGGCTATAGAGAGTCACTCAGTGATTCTCAGATCGAGCCTGTACT
TATCTTGTGGGACGTTATCTGTATCTCTTTGGAATACTGTAATATGAACAACAATAATAATAAACTAGCTTTTTTAAAGATCTGACACATGGAAGTGGGATGCTGAGAATATGTCATTAT
TCCAATGATTGTTTTATGCTAGACCTGAGATACAATGAAGCATTAGAAGGACTTTCACAGGAGAACTAATGTCTTTATTCAATATTAATTACATTGCCGACATTAAGATAGGCATAGCAT
ACAATTATAATAAGATATGATTCCAAAATGCTTTCCTTTGCTTAGTTCTGCTACAGAAAAGCTGGAAAAGAAAGAGAAACAAAGAAGTGAAGTGATTTGCAAAAGGTGTAATATAATAGG
GCAAGTTTGTGTCCTAGCTAAGAACAGATCAGACTGTGTATTCAACAGCCAGCAGAATGAGTATCTGCTTTTTCTTCTGCATTTCAGAGATAGCAACTAGCTGTTAGATGAGACCACTGA
CTCTTTTCCAATCTTCATGTCCAAGATCACACATTTATGTCTTCCTTGAGGACAAACTTTCTTAACCATAAGTAAGTTTTCTTTTGCTTAGGAACAGCAAAAATTCTTTTCAAAGAGACT
ATTTGGCACAGAACAAATTCACAGCAAGAAAGGTTTTTATTTAAATGCGGTCATGGCCTAGACATTGTGGTCTCCTGAAATTACTGATTCCTACACATTGAAAAATTTCACTATAAGCAG
ATTCTACCATGCATAACTGTTAACATTTAATTGGTTTAAATCAGCATGCAGCTGTACCAGGAAAACTACTGTGATTGATTTACCAGAGATTGATTTATTTCTGATATTTTTCCCTTTAGA
ATTATACAAGGAAAGAAAAAAAATGATATGAATTTAATCCTGGAGAAAAATATTATTCTATAATCATTTCAGAAGGAAAAAAAACCTTTTATTTTTCTCTGATTATTTCTGATGTAATCT
GAATAATAACATAAGGAATCTCTTATTTGCACATTCAGCTGCTGGCTGCATGCTGCTTATCCCATGAAAAGCTAAAAGACTACATTATACAGTTCTGTAGTCCCTTAATGCTCATTACTG
CTGCTTTTCTCCACTGGGGCACAGAACAATTTGAATTCAAATTGCAGAGGCAGTTAACCGAAGATTATTCACTATGAACTTCATTCACTGTTGATATGTTTTGTTGTGAGCCACACTGCT
CAACAACTCAAAGGCGACTCTTAGATTTTTCCCAATGATACCTGATTTTTTCCAGGCTTTCCTCTTAACTAGAAGCAGGAGGCACTCAAATATATACAACACTGTGGCTGTCAAGCTCAG
GTATCTGTACTGTGAAATGATCTTCCTGCTTATATTACCAACTGTAGAGAAAAAGAAGCCACAATAATTGCAAGAGACTTAATCGTAGAGAAAAAATACTATATGGCAAAACCAAAGGAG
TAAAATTACTGTCTTTAGCAATCAGTGAAGGAAAGAAAAATGATAATAAATTAGGCATTTCCCTCAAAAATAACTTATTTTAATTTTGTAATACCTAATGTGTAGAAATATTTGTAGAAG
TTCTTCACCAGACAAAACTTTGAAAACATATGAAATTCTTAACCTAAATGTTTTGTTGATATCAATCCCTGCTGCCACAAATTCCCAGTAGTAAGAAAATTACTTGGTATAATAAGTGAG
GTGAGGTTTTTGTTAAATGAAACTCATTTGTTCTATTCCAATGTTGCCCTGATATTTTATTCCCATTTTAATGACTAGTCCCTTTGTTTTTAGAAGTACAAAGAAGAGATTATATCATTT
TATACAACATCTGCAGTGTTAACTGTATTCTGCCAAGGAGTTTTGAAAAGCGAACAGCAAGAAAATACAATACAAAGGAAAAGGATTTGCTCACATTTCCACACAAAACATTTATTTACT
ATTAGTCAATTATTTGAAGACATTTTTATTTTCAGATATTGAAGTAGCTTTAGTGCTTTCTACATCATTTCATGTTGACCAGTTGGTTAAAAAAAGAGTTATATTCCCCAAAACTCAGAA
TCCATCATCTGGTAACATTTTTAATTGATATTAATCTTTCTAGAACTCCTGGAACTAACTCACTGCTATGGCTCGTTGATGCACAATGAAGAGCTACTACCATTTGGAAATAATGCATTT
AAAAATAAAAATAAAAAAAATAATAATAAAAAAACCCCACCAAAGTTCATAATGTCAAATATGCATTTGACAGTGAAGAAATGAAGATAGATTTTAGTCATTTTGAAATCTGGTGATTTT
TTCTTTAGATATGAACTCTGTTCCTTGAAATAGAATTGCTCATCTGAGCCTTGCTCTTAAATATCATACGGTGCACATAAAACCTTTCTTCCATTTCTCTCTCCCCCTCCAACATCTCTG
CTACTGTTCCTACAGCTGTAAAGCTATTCACATAACTTTCTGTATGTTCACCTGTGGCAAACCTTCCAGCTGTCTAATTTGGGCTGTATTCTCCCCTCATGCCCTTACTTGTACTGCAGG
ATTCCATTAGATAATTTCCACACATCTCTCCTAAGCCCTTTACCTGAATTCGGAGTAGCTGACTGAGTAGTAGTCTGAACCCGCCTATATCCATGCTGACTAGCAGTGAAACACTAGATC
ACCATTCACCTGAGCCTATTGGCTGTCTGAGGTTCAAAGCACTGGGAAGGCTTTTGCTTGGGATGAATATAACAAGCATTCTTTGCTTTTTATAAAGACAGTCAAAAAGGTCAGGCTGAA
TGGGACTCTGGACAGCCTGATTCAGATGTAGGTGTCCCTCTTCACTGCAGGGGAGTTGGACTGGATGAGTGTCTCTTCCAACTCAAAAGTCTCTATAACTCTATGATTTAAAACTTCTAA
GAAAAGCTGTCCCATAAAATAATGTGGGAGAATGCTTGTGGGACCAGCAGAAAGCAGAGTGAATAATTATGTATGCCTTTTTTAGTTTTGTCACCAGATTAAAACTGAGTATTGAAACAA
TGCTCTTATGACATGCTCCTGCAGACACTGAAACTCTTCATTACTTTTTTATGTACACATGTAAACCTGCTGTTTCACTTGGTGCTCAGTAGAATGTAATTTGACCAGATGTTCACATCT
CCAATGTGATACATTTTGTAATGAATTTTAAATGTGAAGATGGGCTAATTCAGGCATAGAAGTATTCAAAAGGTGTTACAACAGTAATTTGATCTAATGATAGAGCACATTTTAATTTAT
TTCTGTCTTTTCTTGAAAGTTGTTGAACCATCTTTTCACTTAAATCTGAGAGAAGACCATCTCTGAGTTTAGAGAATGTCACACCCTTACATTAGACCTGGGAAACAACTGGAAATGGAG
ACCATGGATAGAAATACTTATGCAAAACTTAATTCAACATCTGTGTTGCCTTCAGCTCGGAAATTGCATGTTTTTGTTACACAGGTAACAACCAATGACGCATTATCCAAAGGGATGGAT
TGCTTGCCCTTCTACCGCTCATCTCCTGCATGTGGCACTGGTGATCACAGTATTCTCTTTGGAAATCTATCAGCCTTAAATCCAAGACAACAGATTAATGGTTTAACCTCCTTCATTGAT
GCATCTACTGTCTATGGCAGCACTTCCACTGTTGAAAACAAGCTGAGGAATTTAACAAGTGAAGAAGGCCTTCTCAGAGTCAACAGTAAACATAATGATAATGGTCAGGAATACCTGCCT
TTTACAGACCGGGTTCCATCACCTTGTGCACAGGACTCAAATGCAAGTGAAGATGAAAGGATTGAATGCTTTATGGCTGGGGACAGCCGATCGAGTGAGGTCACATCATTGACAGCCATG
CACACACTGTGGCTGAGAGAACACAACCGCCTGGCCCGGGCCCTCAAAGCCATCAACAGCCACTGGAGTGCTGAGACTGTCTACCAAGAAGCAAGGAAAATTGTTGGAGCTCTCCATCAG
GTGGGCTGCCTATTTGCTTATTGACACATTGCAGTGAATATCCTAGAGTGGAATCAATCACAGTACTTCAAATATGTTTCTGTGAGTGGTTTCAGAGATCATGCTGCATACTCTGTGCCA
ACTCTTTCTATGCTTCCCATCTGGCATGTTTAAAGTTTGCTCTGTCCTATACTTCCATGAATGCAGTGTTCTCCTTATTCAGACCTTATATCTCAGTGCCCTGATTTTACGGCAATTTCT
ACTCTTCTTTATATTTCTGCATATTTCTCCCATGTCTGTTTTGTCTGTTGAAGTTTAAAGAAGCTCTTTTAGATACATTCCTTTGTAGTTTTTGGTAAAGGAAATAATTAAAAAACTGTA
TCTCTGCATTTACATAGTGCCCAAAATATTTGCTTTCTTATGGTAATTATATAAACAAGTAGTTGCTCTGTGTAAAAATACTTCTAAATTTCTCAGTGCTGCACTAATGAAACTTCAGGG
TCAAATCTCCAACTCTTCTCTTCCCCCTTCCCCTTTTCCTCTTCCCTCCTTCTCCTTTTCCTTTTTCATTTCCCTTTCCTTTTCCCCTTTTCTTCCTGAAATAGTTATGCAGGCTTGTGT
TTTCCTCACAATTCTCCTTCTTCTCCTGCAGAATATAGCATAAATTGCAGCAATCAAGCATAGGGCTCTATCAGATAAGCACTTATCAGGAAATTCTTCAAACTCAAACAACCTCTTTTA
CCCCCTTTTTCCTCTATTTTCCCATGCTTGTTCCTCCCCAGTCCCTTAACCCCTCCCTTTTTCCACCTTTGTCCTGTTCCTGAATACCCTAGCATCTCACACATTCTAACAGTCCACTTA
AAACATAGCATGCAAAATTCTACACAGGTCCTCTCCTCCCTGCCTCCCACAGTTACTGTTACCTCCTCTCAGCCATCACTCCTTTACCATGCCTGACATTCAGGGGACAGTTTCTTCCAC
TGTCTTATTTTTCATCCTCAGGTTTGTGGTCTAACCAGTCTCTTTAGTGGTCTCAGGGAATAGCTGGTCAAGTCAGCCCATTTTTGATGGCTTGGATAAGCAGGCTATTCCATGTGACAG
TTCTCAAATTCTGACTAGGGCTTTTGTGTTAACAGAGATTCAACATTAATATCATATCAGAACCAGGATAAACTGAAAACTAGTTGACTTTCATATGCTTTCTGATTCTTGGAAACAGAT
TATTTGGTATCAAAACATGACCTTTTTGAAAGTTAATTGGAAGAGGGGGTAGAAGAATTTCTCTATTGCAGTAGGACACTTTATTCTTTCAGAAGTTTTAGTCAAGAGAAAAATAAAATC
TAAAAATTTTGCATTCATTTTAAAAATATTTTATTTACATTAATCACGTAATCTTCTTTGATGTAAATAAGCTATTTGCATCAAATAATTGTATTAATGAGTCAGAATGGTTGTTAGTAT
TTGATAGAAGAAAAGTGAAAATCCAAAATAGATCTCTGCATGTTCACCTATTTCTGAACTATGCCCAGTAATATTATGGCCTGAAAGAAAATTCTTTGTGCAAAGCATTATACCGCATAA
ATCTAAGCTACTCATTATCCCAACCAGTATCACAGAATAATGAGATTTGCTTATGGCTCATTAGAACTGTGTTTCAGTTATATCTGGCTGGTTCAGAGATATTCATTCAAGGGAGGTAAT
TGCAGTATCTCTATTAATGTGGAATGTTAACCAGCACACTAATGACAGCTCTAGTTGAAGTTATCTTGAGATTTCAACTCTAAAATTTTGTTTCAGTTGCTATGCTTTTCTCAAATTCTC
TCTTTTTTGAATGAATAATTTGAAGTGTAATTTTTGCCTGTGGGTGTGTAATTATAGAGAATTGAACAAAAAGCTTTCTTTCTAGAATAAGGAGAATTAAAAAAAATCTTTCTCTAGACC
GTGCTTTTCCTCCTAGATACTTTTTATCAGCATAAATAGCTCTAGTGACAAAAGTTTAATAATAGGAGTTTAACAAAGCTACCAAACATAACAACTGCCTGTTGATATCTTGGACAAAAC
ACAGTTTTTGTTGCACTGCAGACATTTTTCTTTTGTAAGTAGTTGTTTATGTAAGCCACAACAGTGATTAATTCAATTCTTTTCTTGAATGTGAATGACACATGCTTAACTCTCAACCAT
CAACTCTACAATATGCTGTACTAAAAATATATACCCTGACTGAAGAGTGTTTTACACAAATAGACATTTTTCATTGTCATCTGCTAAATGAGGTGAAACTAACTCCTTTTTTTATTTATT
CCTATTTTGTTCTGAGATGTCCGAATGAGAAAAAATAGGTTACAGAATCACAGAATTATTGAAGTTGGAAGGACTCCCTTCAAGTTATTTGAAAGACAGTAGTTAAAATTTGTTCTTCCT
TTAAACAAACAATGTAGACAAAACAGGAAAAAATCACTAAGTGCTGGAACCCTTACTGTCTTAATATTGCTATTTTGTTGTCCTGGTTTCAGCCGAGACAGAGTTGGTTTTTTCCTTCAT
AATGTCTGGTATGATGCTATGTTTTGGCTTTAGGAGAAAAAACACTGTTGATAACAGACTGTTTTAGATGTTGCTGTACTGGTGCCAAGGACATTTCAGTTTTACAGGTTCATGTGATGC
CCTGCCAGCAAAGGGTTGGTTGGAGGGCACAAGGAGCTGAGAGAGGACAGAACTCAACTGGAGAAAGGAATATTCCATACCGTATGGCATCATGCAAAAAAAAAAAAAAAAGAAAGAAAG
AAAGAAAAAAACACTTGGCTGGGCTTGGGGACTGGCTGGGCATCAATCAGTGGCTGGTGAAAAACTGCTTGTGCATCACCTGCACATTTATATGATCAACATTACTGTTATGCATTTTTT
TTTCCTTGTCATTTCTGTCTTAGTAAATGGCTTTTATCTCATCTCACAAGATCTACTTTGTTGGCTTTTTTTTTCCGATTCTCTCCCATATTCCCTTGGCAAAGGTAGGAGAGTGAGCAA
AGAACTTTGTGTGTGATGCTGAGGTTCCTGCTGGGTTAGATCACAACATACATTTATGGTTTGAGAGTTGAAGATGCATGCATGTGTACCAGTTTTGCTCTGGTGTGCCATTTGACTTGT
GAATGTTGAATGAGGAGATACTAGCCAAAGAGTGATGCAGGATACAGATCAATCTGATGTAAGTTCTCTTTGTATTATTATGATTTCAGAGAAGGATCTCTGAAATGATGATGTTACAGC
CAGTAGATCGCAAGTGTAGTTGTCAACTGAATTTAGTTTTCAGTGTTTCACTTCCTTCTATACTTGCTTGTGTTTTCTAAGCATCTTGCATCCTTACTTCTCCCTCATGTACTTATACAT
GAGCTTAAAATGGATCCCTCCTGCACATGACTTGAATGAAACTTATTTGTGAAAGTGGATGATTAGTAACTCCTCTCAGAGCTTAAACTTTATGAAATGATGAATGATAAAAAGATAAAT
GATATATGTTATTAAAAAAAAAAATGTGCTGCACACCGTCACTGCTCATAGAAAGTATAGTTCAGACTATTCACTGAACTATAAAAATGTGTTCATTTTTTATTAAAACTTAAACTGTTT
TACAGTCATTCTTTAGGAAAGTGTTTAGGACTTCAATGTCATCTGTAAATCTTTGAATATAACCATAAGAATTTCAAACCAACTCTGCATAGCATTTTAAGAGATTTCACAATGTTGCTA
TGTTTGATTATTCTGTACAATTTCTGCAATCTTTCCCAAGCACAGGAGCTTGAGCTAATTGGCTCTTCGCTATCTCAGTGAGATGCTATTTTTCGCAGTCACCTCTGGCCAATGGCAAAG
ATTAGTTGTCCTATCAGCCTTACTTTTTTCTTACAGTCATTCATATATTTTCATATTCTCTTTTGCAGAGTTCTTTTTATCTTCCTTTCAATCCATTGTACCTTTATTCGCAACTTTTTT
GAAAAATGCTTGAGGGGTTTTTAAAAGTCTGCTGAACCTAATGAGGAAGTGATATGATTTTCTTCATCTTTTGCACCTCATTTGAAATAGCTTTTGACGTGAACAAAAAAAAAATCCGAA
AAAATAAGTTGAGAGTTTCAATTAACTAGTGTATGGAAGAATTCTGCTGAAGGTGGTCCATCCTAGAGGGAAATCCAGTGAGGATGCTGCCTGAGTTCCTAAGGACATTTCAGAACCACT
GATATAATTCTGCTTTCTGAATGAGAAGGAGAGTACTTTTTACACTAACAGCCTGTTTGACTTTGACTACTGTTGTGTTTGCAGGTCAGGATTTAGTGATGCTATGATAAATATGTACAA
AACTTTTTCTGATGGTCTGTTATCATTTAGATTCTGTTTCTGTCTGTATAGTTACCAAATATTTGGTTGTATTCCTAGGAAATCAGAAGTTTCTTTTCTCAGACATGGCTAAATGAATAA
TACACAAATACTCTTAATCCCTATTACTTTCTGATCATATCGGTTATTAAAGTCATTTAAATACCGAGCATATGGCTTCTGTTTATAAGACAATGGCCATTTTTCATTTTTTTTTACTAA
ATTGTACATTTAAAGCAATTTCAGCCATGAGACTAAAGAAATATTGATTAAAATTAATTTCTTAATGAGACTTCTTTGTAAATCTGAGTGGATGCTATCAGATGTCAAATGTCTCCTAAG
AGGAAATTGGATTAGTACTAATATAATAAATGTTATGAGGAGATAAGACCACTCAGTACCTTGCAGGTTCAGACCCACTATACCCACATAAAGTTCCTATGCTGTTTCAAACACCCAAAC
CAAACTTATTGCTCATAAACAGACTCAAAATAAGTAATAAATGGTAGCATAGTTCATTGCAGTTTCTTGTAATACCTTTTCTATAAAGAATTACCACTTTCTAGCTCTAATTTTATTGAC
ATATTTTCAGACAAGAATGTTCCTTTGTTTTCACAGAAGAATCTCAATTATTTCAAATCTTTCAAATAATTCTGTCATAGTAGGGAGGAGTTCAGGTCAAAGAATTTTAAGAAAAATATT
TTTTTGTTTGTGACCTATTTATTCTTTCTCTAACACTTATACATATGTCAATTACAGTGAGTTTACCCTTGTCTTCATGCAGACAAATTCAGTAAGATTGTTCAGAGTCTATATAGAGGA
TACTACATGCTGACATACTTTGAATACTGTTCTCTGTCAGATTCCAGATTCTTTTTTTTTCTTCTGCTGTATCATTTTAGTCTGTATTGTCTAAAACTGACCTCTACTTGGTGGAGTCTT
ATTTAGAAACCATAAGTTTCCATCATACATATGTCTCGCCTAGCTGAAAGGAGGCATTTGACTCCTTCTTACCTTTAGCCTTTTAATTCTCATGTTTTGAAACAACAGTTCCTCTTTTGC
TGCCAAGGAAATTTGAAATTAAGAGCTTGCCCCTGGAGCAAATGAAAATTTTGAATTGACCTTTTGTTTGGGCAATCCAGCCTTAATGAGCTGCTTAGTTTGGTATTTCATTTTAAAAAA
GCCAAAAAAAAAAAAAAGATTTTCATATCAGAATGTTTGTCATATCAGAGCTGATCTAATCTTATTTAAGATCTTTGTGCAGCTGTTAATATGTACTTATATCCTTTTCTATCCATGCTT
TTGGATTTCTGTTACACCTGCCTTATTTGTACTTTCAAGACATGCTTGACCCCAAGTCAAGCTGAACCAGTATTTGAAATTCTGTATTTCTACCTTTTGAAATAAGACAATGTGCCATAT
CTTGCCTGTAAAAACTAATTAAATCTAAATTTAGAAAGAATCGTTGTCTTGCAAAATCTTTGTGAATGTAGCAAAAGGTTAACTTCTCAAATGACAACGTCAGTATTAATTTCCAGCAGT
TATTTGAATTTTGTTGTATGCTGTACTTAGGGATCTCTAAAAGGACTCCTCACCTATTGTCTTTCAAATGTTGTGTTAACTGCACGACTTAACCTCAAATAGCTGCAAACATAAAGATGT
TACCCCTCCCTTATGAGAAAAGTGACTGAACTCTGCAGGGGCTTTCTTGTCTCTTTGTCATGCCTAAGATAAAGATACAACTTTCTCAATTCCTAATTTTGTGACAGCTAGCTTTTCAAT
ATCCTTTATGCCAAGCTCAAAGTACATTTTTCTCTGTATTTTCTTGCACACTATATTGAATCTATAATGTATTTTATTGAATTCACTATGCTTTATAATCATCCCTTTGTGCTTTATTGA
GCGCAGTGTAATCTTTAACATATAACACACTTTCATTTTATTTGGTGTATTAGATCTTATTACTTTGTGTGTGTGTGTGTGAGGGAGAGAGAGAGAGTACTTGTATACTTTTTTCATGTA
ATAGTAATATGATTTTGTAATAATATATTACATAAACTTTTGGCAGAAGGTGTTAATCACCATTTTCAATTTTGAAGTGTGTTTTTATGAGTCTATAGACTTTAGCATAACATGTCTACT
AAAGGATTCTCAGAACCAGTATTTCAAAACCTGGTCATTTTAAATATCCAGAAAAGACGATTTGTGTTACATACGTATGCCTGAAAATAGAATCTGTACACATTAACAGCCATTCATGGG
CATTACAGCTTATGCCCAGGCTTTAAACCTCAGCAGATCTCTTGTGAGCTGGATTTACCTACTTGAACTGGAAGGGAGCAATACTGGCAATCTGCCCAGTAGGTTTTTGTCTAGCATTAT
TGTAGGATGCTAAATTAGCCTGGTTAGTGTACTGTGTACTCAACTTTGCTACTGGTTTTCTCTTGTCATTTTTTCCAGACTACACAAAGAAATACTAACATCTTGTTCCTTTCAAATTTA
CACTGCTGTTAGTCGTGCTTGAGTGATCACAAATGAGTGATGAAAAAGGCATTCTGTACATGTGAATCGTTACCATTCATCTATCAAAATACTGAGTGATTTTTTTTTCTTTTCTTTTTT
CTTCAGATCATTACTTTAAGAGATTATATTCCCAAAATCATTGGCCCAGATGCTTTTAATCAGTATATTGGCCTTTATAAAGGTTATGATCCCACAGTGAATCCTACAGTTTCTAACGTA
TTTGCAACAGCTGCTTTTCGTTTCGGTCATGCAACAATCCAACCGATAGTAAGGCGATTGAATGCACAGTATTTAGATGATCCAGAACTCCCAAATCTTCATTTGCATGAAGTTTTCTTT
AGTCCTTGGAGGCTTATTAAAGAAG
GTATGTTTTTATTTAAACTGTTTTTTGTTGTTTGTGTGTTTCTTTATTTTGTTTTGTTTGCTTTTCCCATCAATATTACAGTTTCTTTAATGTTG
CTGGTCTTAAATTAGGAATAAAAACATTTATTTAAGTGCACCACTGATTTAGGTTGTTGAACACATTCCGTAGAATTAATACTGACTGAAACAATTATTTTAGGTAAATAGTTCTCTTAA
TAAAATAGATTACTCTCCAGACTGAAACAGACTGACACACTGACAATAAACTGATCTTTTGTATGCATTTTTTGTGGATAAATGTATTATCAGATTGCCAAATTTTGTATCCCAGAGGAA
GCAGGTGGAACATTTTCATTATATTACCACAATTTCAATCTTAAGTATTTTTTTTTTTTTAAAGGCTACATGGCCAATGTTTAAAATCAGAGAAGCATACATGCATTCACATTTGTTGAG
AACAGTATAGTGGTTCATATACATGCTGTATCATTTTATTATTTTTGTGTTTGAAGGAGGCTTGGATCCATTGATAAGGGGTCTTCTTGCACATCCAGCAAAACTGCAGGTGCAAGGTCA
ACTGATGAATGAAGAGTTAACAGATAAGCTGTTTGTGTTGTCCAATAATGGTTCACTTGATTTAGCATCGCTGAATTTACAGCGTGGCCGTGATCATGGACTCCCAG
GTCTATTGATTTT
TCTTAAATCTTCTTCTAATCAGCAACTGAGCTATCAGTGTTTGTATTTGGGATGTAATTGTAAGTTTTTAAGTAACAGCCTTTTTATAGGAAACATAACTCAAGTCTCTTTAAAATACAA
GAAGCGAATATTTTCAACTTTGATAGAAAAAAATATTCCCCAGCATCTGAAATTAAAATAACCTCCCTAGTCTGCATTCTGAAATGTGAAAGACCAGTACTGATGAGTGGATCTGGGTGC
TCCTGGCACTTGAGACTCCTTCCTGCAGGATTCAGCTCCAGAGGAGTGGGGTTTTCTGACTGCAGCACCTACTTGGTGTTGAAATGTATGCAGGAGTGGTTAATGACTTAAGTGAATGTA
CACCTAACTTTTAGAAACATTACATTTTTATACCTACTTTTTGCATTAGATTTCTTGCTCCAGTTAGTCCAGGGTAAGGCTGAACTAACAGTCAAGGACCATGAGCAGCTGATAAAACAT
ACAGTATGTTCACAGTCCTGTGTAAAAACCTCCTGTAAGTGTGCCACCATCTCTAAATGCAGAGGCAACAACCCTCTGCAAAGCAGACAGAGACTCTTTCATTTGTTTTGTAAAACTGTG
TCCTGATCCCCTGCCAGATCAGACCACATGTCTGCATGAATAAGGAACAAATGTGGTTACCCTTTTATGCTCTGAGCCTGATGTCCTACCCACAGAATACAAGTGACTGATTAACTAAGG
TTGTTATGTTTCATGGTTACAAACATCTCAATTTCTCCTGTTGAAGTTGTGTGACTGTAGCTAGGAATATGGATCTGGCCAGTAGAAATGAAGTCTGACTTCAGCCTGGAGTTTATAAGT
CTTAGCCAAATAGGAGTAGAAATGGAGTTTTGGTCTCCAGGACCAGATAAGCAAGTTTTACTGGGAGGTGGGAAAAGTTAATTGCAGTGATGTAAAAGAATTGGAAAAAAAAAAAATTAT
TTTCCAGGGAACTAGACATGACCTACAACAATCTCCTTAGTAAAGAGATTTAGGTGCTAATGGAATTCAGAGTTGTTTTGGGTTGTTTTGTTTGTTTGTTTGTTTTTGTTGTTGTTTTTT
CTCTTGTTCTTCATCCAAATTCTGTATTTCTGGATCTGAAAATCTCCAAACACAATGAGTGCTCCTGTCTGGATTAGCTCAAAATATATCCCTTTATTTCATATTTGCATTGCTTAAATA
TGGGAGAACTTAAACTCTTGTCTTCCTTCATGAGAATGATGTAATATTTGCATACCTTGTAGCAGCAGATCCTGCTGTAATTTCTCCAATCATTTTAACCAATAACAGCAAGACTATTTT
TAGTAATAACTGTCCATGATTGTAATTAAGGTTGTTAGAATCCAGTGTTTTTGAATGCATTAATTTCAAATATCATGCGTAATAGTAATCTAATCTTCCTTTTAATCATCATATTTATAG

GTTATAATGACTGGCGAGAATTCTGCGACTTACCAAGACTGGAAACTCAAACTGACCTGAATACAATAATAACTAATCAGAAAGTTACTGAAAAAATCATGGAATTGTACCATATTCCTA
GCAATATTGATGTTTGGCTTGGTGGTTTAGTAGAAGACTTTCTTCCAGGTGCTAGAACAGGTCCCCTGTTTGCCTGTTTAATTGGAAAGCAAATGAAAGCACTAAGGGATGGTGATCG
GT
AAGTTTATTCATGATGCTGAATCTTTTGTGTACCACTCAGCAGCAACTGTCATTTACAGATACATGTGGATACTTCTTAGCATGTAAAACATGATGCTTAAACATTATGTAAACAAATTA
TTCACTGCCAATACCTAATTTTTGCGTTAGTCTCTCCAGTTTTCTTGGGTAAACCTCTCTTTATTCTTCTTTGATCTGTATGTAGTCTCAACCTCGGACATAGGGATTGTTTCTGTAACA
GTGGGATGCTCAACTTTGAAATTCTGGTGGAAACTCAAGGTGCCAGCAGCAGTTAAGTGTTCCAGGAACACATCTCCTTCTGTGTAAATGGATGTACAGGTCTTAACTATCCAATCCCTG
AGAGATGCACTAGTCTGAGGATCCTTAACTGAAAGGATCTCAACATTTTACACAGAAAATTCATAAGACAGAGGTGGAGAGTTGCAGTTAAGGCTTCCTAGAAAGGTAAATAAAAACACT
GGGTATGTGGTCTTATGGATATCAGGAATGCAGAGTGCTCCCAGAACTGCCACATTAGACACATCAGATGAGGTTGTCACTTCACCTAGTCCTCTACAACTGCCACCATGGTCTGTCTTG
TGCTGGTACAACACTTCATACCAGGAAGGCAGAAGAAATGCTATTTCAGGCTTCAAAAGGTTTTGAGATGCTGCTTTTATCTTTCTTACTTCTGTTCCTGAAGCAATTATAAAACCAACC
TTTGTTTTTCATTTTTGTCATATACTTGTGGCAGCAATTTTGAATATCATGAGAAGACTATTATAAACTATTCACACCACCTTAGCAGTGGTGTTTAAGTACATCTGGCCCTTATGCTCA
CCTTTACACTCCTCTCAGAAGTCGCTGCTGTGGAAAGAAGCCATTACATAAATAAGCATCTGAGACAGAATTTAAATCTGAACTTTAAAAACTGTTAATAAATTAGCTCACAGGAAAAAG
CAATATTAATCAAAGTTAGTATCTTACTAAGACAAGCCATATAGACAACAAACATTCCACTCAGATGCAACAAAAACATGGATGTAAGTTTTCTGACTTGTAATGGCATCCTTGACTCTG
TCTGGAGAATGATGATCTATTGTGGCCCTTCCAGACTTTCTTCTTTTATCCAGTGTCACATGATGCTACTTACATTAATTAAACTTAAGCATAATTTAATGTGTTATCTTTAAACTGAGA
AAAGATTAGTTCTAATAGTAAAAGAACACCTCAAGTTTATACAATAAATTTTGTGTCTGCTAATTTAAGTGGGAAATGGGGTTCGGTTATTGGATACTATGATATGGAACTATTTAAGAA
AGTTAGGAGTGTATAACAATATGTTGTAGTTGTCATAGAGTAAGCATAAGAGTGAAAAAGTCTAAAATTCATTGCAGTGGCTTGCTGCATAATGCGTTGGATATTGTATCTGCATTAGTA
ACACTACATGCATACCAGATAGACCTATTTGTTAGATAAGCCTACATGTTAGTAAGTAGGAATTTCAAAACATCTTTCTGAAGTTACCAATTTAAGTTCATAAATCAAGACTAAGTGGAA
TTTTTAACTGACTGAATGCCATCCTCGTAACTTTAAAATCTACTGTCAGTATCCTGCTGAGAAAAAGAAGAGATTTCTTTCACCAGTGTAATAAACCCATGACCTTATGCTGGATTTGAC
CTTAGCCTGTACTAACTTCAGCCATATCACCTGGAAACAATTGTTTTTGTTCCATCAGCTGTTACCTTCTTTTCTGTTCCTGCTCTGAATCCTTGTCTGATCTCAGGGTCTGAAATAACG
GTAAAGACTTTGTACCTGACTTTACATCCTTAGCATAAGAGGTTTGTGCCTCTATTTATATATATATATATGCATAAGATTAAGTATCGAATTCAAATAATTTGCATCTTTTTTTTTTTT
TTTTTCTCAGTGCTGCAAATTTCTTTTGTGGCTACAAGCAACTCAGCACATGCAAATTAATTAATAGTTTTAGTTATCTTACTTTAACAAACCACCTGAGGTGATCAGTACGTCAGACTC
ACAACAGCCTTTCTGTGACTTGTAAGATGGATATGCAGATAGAGTTAGAGTTTCCATTTATTATTCTTGTATCCATTTACATTTTGTTGTAATTATTTTTTTTTTTTTATGTCTTCTTAT
GTAGGATACTCTGATAGTAAGAGTAATCAGTTCTTTTAATTTAATCGTTCAAAAATATTTCTATCAACCTTTCCAGATTTTGGTGGGAAAATGATAATGTTTTCACTGACGCTCAAAAGC
ATGAACTCAAAAAACACTCCTTGTCTCGCGTGATTTGTGACAACACGGGAATTTCTGATGTACCCATAGATGCCTTTCAACTTGGAAAGTTTCCACAGGATTTTAAACATTGTAGTAATA
TAGATGGAATGAATTTAGAAGCTTGGCAAGAAACCTTTCAGGAAG
GTAATTTGGTAATTTTCTTTTTTTGATGGGGGGGAGAGTAACCTGTAGTTAGAGCACTGACTGTGGTTATGCAGG
TCTTGAGTTCCTGATCTGTCATGGAGTTTTAGCATTTCTGTCACTTAGAAATGAGATCTAGATCTTTCTCTCCTTTCTCAGTTTCCTCCTCTGTAAAAGGATACTGTCTGCCATCTTCAC
CTTGATAAAGCAGATGGCTTTGTGAAATACACAAACATTATGTTAACTGGGGCAGGAGTTCTTAGAAGTATAGGAAATACATTAACTAAGATCTCTGTAGATCACACTGTTTGGAGGTAA
AGTTATTTTTATAAGACTTGTAAGTCAGACCTGAGGAATTCCATATAAATTCTTGTCCAGAAATGAACAATTAAATTCTTGATCATCTTAAAGCATGTGAATAATTTCACTGAAGTTGAC
TTATAGCAGTAAAGGAGAATAATGTCCATTTTTGAAGGTAAGCTGGTATGTTTTTAAAATGTGATCTTCTATTTGTAGAAGAAATGTGTGGAACACCAAAGCATGTAGAAAATGGAAATT
TTGTATATTGTTCAGAATTTGGGGAATCTACAGTGACTTATTCTTGTCAACATGGATTTCTGTTACAAGGAGAAGAGCAATTGATCTGCACAAATAAAGGCTGGAACTTTCAGGCTCCTG
TTTGCATAG
GTATCTCTCTGGATATATGTATTTGTTTCTGATTTTTTTTAAAAGCTCATCTAACACTGTTTAAGAGAAGTGTTTCATTTCTTGTCTTGAAATGTATTGCTTAAATGTCAT
TTTTCCTTTGTGTTCCTTGTAAATGAATGCAATTTGTAAGATAAAGATAATCAGTCTGCTAGGTTTGTAAGTATGATGACACTATAATGCAAAACTTTCCGTGATCCAGAGTTGCTATCT
TAATCTTTACCTGTGCTGATTCACCATTAGGTTTGATGACAGGGAAATGTCAATTAACAACCATCAGGGAAAGAAAAAAAAGCAAGTCTGTATTATACATTCCTCCTTCCTACATTCAGT
GTAATAATGAATCAGACTGTTGATTAAGTTATTTTCCTAAAGTGATTCAGTGGACACTCTAGATACAAAGTGAAATCAGCTCTTGTAGTTGGTGTGTTATCCTAATAAGTTAAGCAAAGG
TGACAAAGAAATACTGAATATGAGAGAAATTAAGCAATTTAATTATCGTTCTATTCCAAATTCCATCCCTCAAATATGAATTAAAAAATTTGACAGAAGTGAATTACTTCTGAAGGTAGA
AAAGTAGAAGAGTTAAGAAATCAGTTAAAAGACATTTCATGAACATTTTAAAAAAGAATAATTTTCTGATGATTTATTTACTATTTTCTCTCCTCTTCTTGCTCTATTTTTGCTACTGAA
AGGAGGTTTGACAGAAAGAGAATATGGCAAGTATTTTGTTGCAAGACGTTCCCTCTTCACTGCTATGAGGGATGAATTCTCTCTATGTTCATATTCCTAATGATGATGTTCTTAATGATA
TATATTTGTGTGTGTATTTCTATACACATATGGAAACTGTTGCGCCTCATAAGAACATAAAAGAAAATCAAACCTGAAAAGGCTGCATTTAGGAATATAAAAGGGATGGTGTTAAATTAC
TTTGTATGTAAGGGCTGCAGCTGATCTGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCAAATGAATTTTGCAGCTCTTTCCTTTATTCATATCCTATTTATTCGCTGAATCCCACCCCC
ATAAATACCATATAAAGCAGTAAAGCTGTTAAATGAATTATAATAAAATCTTTTCAGTAGATTAATATTCTGGCTACAAACTGTATAAATAACTTATATGAATGAATCATTCCTTATCCT
AGTTTCTTTTAATATGTTCAGCACTGTAAACAAAAGACTTTATATCTGCTATAGGAAAACAAGCTGCTGCATATATTAAATAAGAAATGCCTTTATTAAAAGAAAGCCATCAAACCCCAC
TTATGCAGATGCTACTTCAGTTTTACAGTAGAAAGTACTTTGTCCCATGCATGTTTCTGCAATGTGTTCCCATTCTAAATGTTCAGCAAATTAGGAATAAGTCAAGCAATATAATGAGGA
GGATAGAGCTTAGCATTTCTGCAGATGGTTTCAAAATTATATGCTTCTCTGGAAAAGACAGAGTGGCCTGCTGACAAAAGCATAGAAATTTGAGAGCTGTTAATTCCTGCTTACTAACTT
TGGCTTTGATAGAATCATTTCTATTGAGTTCAGGAAGACATTTAGTGTTAGACTGTGCTACCTTTATAATAAGTGCCATCTTACATTGGAGAGATAACTGTGTTTACTTTGCTTTAATAA
AGTACCATAGCCTTTGAGCAGTAGGGTAGGCTGGTTAGATCTGACATATGCTTTTTCATGGCCATAAAACCAATTAGTTAGTTAACAGATAACATGAGTATTAGCTGAAATAGAACCTCT
AAATTACAGCGCAGAAAAAGTCTGTTCAGTTTTTGATTTCCCAGTGATGATATCAGTGGGAATTAAAGTAAAATGTAGTCTTGAAGGTGTAATAATTACTAAGGACACTTCATCCTGAAC
AACAGACTAGTTTACTACTTCATAAAGGCATTATGGGAGATAGTATTTCTTAAGGATTTGTAAATTTAAGATTATTCCTTGTTTGATTACTCTTTTGACTGTCTCAGTTGACATTTAGCT
TTGGACACAGCTGCTGCTTTGTATTAAAATTTAAGAAAGGATCAGGTTTGATCCCATTTTCAGTGACAGATTTCCCCAAGTAGTCTGAGTGACAACATTAAGCTAAGCCAGTAAACCATT
TTTACAGGGTCTCTTTCTAATACTAATACTGATGGGAGGGGGGGGGGGGGGAAGATACATAGACAGAAGGAGCAGCCAAATATATATATATATACATATATATGGTAGAGAAGGAAAGGA
AAGGAATCTAACCAAAAAGAGAAGGCACTGAAGACTCAGAGAGTTGTCTGCACATGGACTTCCAGTGTTTCCTAAGGCAAAGAATCTGAGGTGTTGAACAGGCTGGCAAATATTGCACAG
CACTCATGGGAAACAATCTAAAACAGTGCAGGATGTTTTAGGCAACCAAATGAAGTTGTGTAAGCAAATATAACACAGAGGAAGAGAGATGCAGAAATATGAAAAAGACTACATTCTTTC
TCTCACTGTGTATTTTCTTTCCTGCACTCCACACTGATTCCCCTTTCATTGCATAAGACTGAAAGCAAAAGGACTTGAATGGCCTCAAGGAAAATGCACTTATGTGCATCTTCGAATGGA
TAAAAATGGATAATTCTTCACATGCTCATCATTCTGACAAGACCCCGCCATTGCTCTGAGCTTACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCGCTCTCATTCTGACAGATATTGCCATTTCACAGAATTTACATGCCTTCTAGGAGCAATAATTTTTTCA
GTAGTATCACAGATATATCCAAATCTAACCGGAATCCTAGACTGTTCAGAGTAATGTCTGGAAACATATAAAACCATTTCAGTGTTACTATTTTTTCATAACTTCTATAGAGCATGGTAT
AAATAAGGTTTATAAAGAAACTGGAAGCCTTAGGACATGAACCCATTCAGCTCAAAAAGTCAAAAATTAAAAAAAAAAAAGGTAAAAACAATATCAGTGTGAAATGCACAAAAATTCACT
TATGAATACTTGTAGCGTGTGTGTAAGTTATTAATCCTTCTCTAATTTGTAATGATTATTGATCACTGTTTTGCAGACATCAATGAGTGTGAAAAGGAAATTAATCCACCATGCTCTCCA
ACTGCTAAATGCATTAACACTAAAGGCAGCTACAAATGCTTCTGTACTGAACCGTACAAACTGGCAGAAGATGGAAGAACATGCATTGATAGCATTCGTGAACCTGCTGTCCATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGTGTTCATTGTTTTGGGAATTTCAGCAGCTATAGCCTTCACAGCTGTTTTCTTCTCTTTCCTTCAGACAGGCAAAGATGTCCTCTTCGAAGCAAGTGAAGATAACTGCATTACT
GAGGCAATCCAGAAGGCTGTTAATTTGGTGGATTATGCTACACAATATGCTCTGGAAAG
AAATATCCAAGATAAGGGAATAGCAAGTCCTACCTCACTGCTGGCCTTCTCAAAATTTCCT
GAACAAGACAGTCAAGATATTTCCCAAGCAGCGGAACGAATGGAAATGTCAATTCAAGTGTTGAAACAAAGAGTTTGCCAGAAGTACAAGCGTTCTTTGCATCCAACTG
ATCTTTTATCA
GCTGATCTGCTTACTATGATTGCTAACATTTCTGGATGTCTGCCTTATATGTTGCCACCAAAATGTCCAAACAATTGCTTAGCTAATAAGTATCGACTTATCACTGGTGCCTGCAATAAC
AG
GGAGCATACTAGATGGGGAGCATCCAACACAGCCTTGGCTAGATGGCTCCCACCAGCCTATGAAGATGGACTCAGTCAACCTCGAGGATGGGATCCCAGCGTTCGATACGATGGAGTC
CTGCTACCCCTG
GTTCGAGAGGTGACAAGAAAGATAATTAACGCATCTAATGAGGCTGTCACCGAAGACAACCTATATTCTGACATCATTATGGTGTGGGGACAATACATAGACCATGAC
ATTTCATTCACACCTCAGAGCATAAGTAGAACCAGCTTTTTAACAGGAAAGGAGTGCCAGATGACATGTGAAAGACAAAATCCATGCTTTCCGATAAAG
GTAACAACCAATGACGCATTA
TCCAAAGGGATGGATTGCTTGCCCTTCTACCGCTCATCTCCTGCATGTGGCACTGGTGATCACAGTATTCTCTTTGGAAATCTATCAGCCTTAAATCCAAGACAACAGATTAATGGTTTA
ACCTCCTTCATTGATGCATCTACTGTCTATGGCAGCACTTCCACTGTTGAAAACAAGCTGAGGAATTTAACAAGTGAAGAAGGCCTTCTCAGAGTCAACAGTAAACATAATGATAATGGT
CAGGAATACCTGCCTTTTACAGACCGGGTTCCATCACCTTGTGCACAGGACTCAAATGCAAGTGAAGATGAAAGGATTGAATGCTTTATGGCTGGGGACAGCCGATCGAGTGAGGTCACA
TCATTGACAGCCATGCACACACTGTGGCTGAGAGAACACAACCGCCTGGCCCGGGCCCTCAAAGCCATCAACAGCCACTGGAGTGCTGAGACTGTCTACCAAGAAGCAAGGAAAATTGTT
GGAGCTCTCCATCAG
ATCATTACTTTAAGAGATTATATTCCCAAAATCATTGGCCCAGATGCTTTTAATCAGTATATTGGCCTTTATAAAGGTTATGATCCCACAGTGAATCCTACAGTT
TCTAACGTATTTGCAACAGCTGCTTTTCGTTTCGGTCATGCAACAATCCAACCGATAGTAAGGCGATTGAATGCACAGTATTTAGATGATCCAGAACTCCCAAATCTTCATTTGCATGAA
GTTTTCTTTAGTCCTTGGAGGCTTATTAAAGAAG
GAGGCTTGGATCCATTGATAAGGGGTCTTCTTGCACATCCAGCAAAACTGCAGGTGCAAGGTCAACTGATGAATGAAGAGTTAACA
GATAAGCTGTTTGTGTTGTCCAATAATGGTTCACTTGATTTAGCATCGCTGAATTTACAGCGTGGCCGTGATCATGGACTCCCAG
GTTATAATGACTGGCGAGAATTCTGCGACTTACCA
AGACTGGAAACTCAAACTGACCTGAATACAATAATAACTAATCAGAAAGTTACTGAAAAAATCATGGAATTGTACCATATTCCTAGCAATATTGATGTTTGGCTTGGTGGTTTAGTAGAA
GACTTTCTTCCAGGTGCTAGAACAGGTCCCCTGTTTGCCTGTTTAATTGGAAAGCAAATGAAAGCACTAAGGGATGGTGATCG
ATTTTGGTGGGAAAATGATAATGTTTTCACTGACGCT
CAAAAGCATGAACTCAAAAAACACTCCTTGTCTCGCGTGATTTGTGACAACACGGGAATTTCTGATGTACCCATAGATGCCTTTCAACTTGGAAAGTTTCCACAGGATTTTAAACATTGT
AGTAATATAGATGGAATGAATTTAGAAGCTTGGCAAGAAACCTTTCAGGAAG
AAGAAATGTGTGGAACACCAAAGCATGTAGAAAATGGAAATTTTGTATATTGTTCAGAATTTGGGGAA
TCTACAGTGACTTATTCTTGTCAACATGGATTTCTGTTACAAGGAGAAGAGCAATTGATCTGCACAAATAAAGGCTGGAACTTTCAGGCTCCTGTTTGCATAG
ACATCAATGAGTGTGAA
AAGGAAATTAATCCACCATGCTCTCCAACTGCTAAATGCATTAACACTAAAGGCAGCTACAAATGCTTCTGTACTGAACCGTACAAACTGGCAGAAGATGGAAGAACATGCATTGATAGC
ATTCGTGAACCTGCTGTCCATTAA

Retrieve as FASTA