Entry information : AImeLPO
Entry ID 7970
Creation 2011-02-03 (Christophe Dunand)
Last sequence changes 2011-02-03 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2011-02-04 (Catherine Mathe)
Peroxidase information: AImeLPO
Name AImeLPO
Class Lactoperoxidase    [Orthogroup: LPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Ursidae Ailuropoda
Organism Ailuropoda melanoleuca (Giant panda)    [TaxId: 9646 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AImeLPO
start..stop
S start..stop
CfaLPO 1335 0 6..717 1..714
PpyLPO 1317 0 6..717 1..712
HsLPO 1314 0 6..717 1..712
MmulLPO-B 1313 0 6..717 1..712
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5..17 13 N° 2 3801..3878 78 N° 3 5033..5120 88 N° 4 9377..9537 161
N° 5 10857..10974 118 N° 6 11381..11510 130 N° 7 12270..12476 207 N° 8 13713..14037 325
N° 9 15881..16041 161 N° 10 22490..22742 253 N° 11 23601..23774 174 N° 12 24460..24697 238
N° 13 24885..25092 208  
join(5..17,3801..3878,5033..5120,9377..9537,10857..10974,11381..11510,12270..124 76,13713..14037,15881..16041,22490..22742,23601..23774,24460..24697,24885..25092 )


exon

Literature and cross-references AImeLPO
Protein ref. UniProtKB:   D2I2K0_AILME [Fragment]
DNA ref. GenBank:   NW_003219128.1 (254696..229605)
mRNA ref. GenBank:   XM_002929399.1
Protein sequence: AImeLPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   717 (693)
PWM (Da):   %s   80691.28 (78113.8)  
PI (pH):   %s   8.37 (8.26) Peptide Signal:   %s   cut: 25 range:25-717
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLAAMRVLLHLPALLASLTLLQAAASAANAPPTTTAAISDAVSQVKVQVNKAFLESRTRLKTAMSSEEPTTRQLSEYFKHARGRARTAIRNGQVWEESLKRLRQKVALTNVDPSLDLTALSSEVGCDAPVAVVKCDEDSPYRTITGDCNNRRNPALGAANRALARWLPAEYEDRLSLPFGWTPGRTRNGFPVPAREVSNQILDYLNEEGVLDQNRSLLFMQWGQIVDHDLDFAPDTELGSSEYSKAQCDKYCLQGDNCFPIMFPPNDPKLRTQGKCMPFFRAGFVCPSPPYRSLARDQINALTSFLDASFVYGPEPSLASRLRNLSSPLGLMAVNQEVYDHGLAYLPFDIKKPSPCEFINTTALVPCFLAGDSRASEQILLATSHTLFLREHNRLARELKRLNPQWDGEKLYQEARKILGAFVIITFRDYLPIVLGDDMQKWIPPYQGYDKSADPRISNVFTFAFRFGHLEVPSTVSRLDENYQPWGPEAELPLHTLFFNTWRIVKDGGIDPLVRGLLAKKSKLLNQNKMMTRELRNKLFQPTHKIHGFDLAAINVQRCRDHGMPGYNAWRGFCDLPQPQTLKELNAVLKNRRLAKKLLELYGTPDNIDIWVGGVAEPLVERGRVGSLLACLLGKQFQQIRDGDRFWWESPGVFTEKQRDSLQKMSFSRLVCDNTHITKVPRDPFQANSYPQDFVDCSAIDKLDLSPWASVEN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACTTGGCAGGTAAGACTCATTAACTTTAATCTTTCCTGATTTCTGCAAAGTTGATGATGAAATTTCCTAAAGTCTTCTTAGAAATCTTGGTACTGCCTTTGGACTTGTCTTCATTG
GGTATTTTTCTGGTGCCAGATTTGGCTGCCACCACGGCAGTTCATCCCTGTTTGGTATAAGGGCGAATGTAATTAAATCCACTGTGGGGCAAGGCAGCTTTTCTGAGTCTGAAAACAGTC
ACAGAATCATAAACTTTTAGGTCTGGAAGGTACCATAGACCTCTCATCCATCCTCTTTAGAAACTGAAGCCTAAGAGATAACACAGAGAGTTGGGGATAAATAGTAACAGAATGATTCTC
CATATGGTGTTCTTGAAACTAATGTGATATCCTGTGACATTCTAAATTAGAGTGAAAATTTTGCTGTGTTTTAAGGGTTCCCTAAGTGGGGGCTCTCAGATCTTTATCTTGTTTCCAGCA
TCGCATGCCTGCTATTTCTAGCATATCTGAACCAATTGTCCCTGAATGTCTCGTCCCAGATGTCTTCAATGCCCTTGTGGACACCTGAATCCTAATCAGACATATGAATTGCAACAATAT
TAAATGGGCTTCACTTTGGGAGAATGGAGTGGTTGGATTATACTGTGTTTTATGTGATTGGGTGTCCCAAACCCTGTGGCTGAGGTGTGGGATTGTTTCTTCTAAAGAGATCTCGATAAG
AATTTTCTCCTCACTATTTTCCTCTTGATCCTGGGGCTGCTCAAAGTGTTATGGTGTGTTTGTTGGTTTTCCTACTGGCTCATCCCACCACCTCAACAGAGCTCTTGTCACTCATGGAAA
GGATCCTGCTAATTCCTTCCCTTCTCCGGCTTTCCTGCAGTCCCTCTCAGTGACTTCTAAGCAAATCTGAAAGCCTGTCTCTGGAAGGCCTTGGTACTCAAGAGTGTGGTCAGCAGACCA
GCAGCATCAGCATCACCCTGGGGTCCCATTGGAAGTACAGGCTCTCAGGCCCCTTCTATGACCTTCTGAGTTAGAATTTTCATTTAACAAGGTCTCCAGGTGATTAGTAGGCACATTGCG
TTGTGGGCTAAGGGACCACCCTCACCCTCTGCTCCCTCCAGATGCTAAACGTCTCTTCCCTAGGAGTTTCATTCATTCAACATATACCCAACACCTATTATGTACCAACAGTAGGCTTGG
GCATGGGAAAAAACAAAAGTAAGTAAGACCTAGCCCTTGAGGAGCTCATGGTCTGATAGGGGAAGCAGACATGAGAACAGTGATACGGGATATAAGTAGAGTGCTAGGAGAGGACAGGAA
GGTGAATGACCTAGCTTTGCCTGGAGAAATCTGCTGTCCACTTCACAGAGAGGGTAGCATTTGGCCTGACTGTTGAAGAATAAATAGTTCATCGGGCTCTGCAGAAGAGAGTGTGAGTAG
AGGCAAGGAATTGGGGACCAACCTGCATTAGAGAGGCAGAGGCTGTGACTCTGTCTCCAGATAATGCTTCAGGTCACAGGGAAGCCTCCAGGCTTCCAAAGGACTTGGAAAATGATTTCT
TCACTGAGCATGATGACAAGAATGTGAACAAAATATCCAAACATCACAGGAGCCTCTTGCTGTCCTCTTACACTCTGAAGCCCCATGTCCTTCAACCTCTGCCCTGCTTGGGTCTGGCTG
CAGACAGTGTACCTCCAGGTGTCCAAAGATCCTCCAGGATCTTTTAGCACATCTTTTTTCCAGTGCGGTGGCATGAACTTGCATTTGCCTGGCTCTGCTTTCTGTCCTACATCCTTCCTT
CAAACACACCAGGGAAACTGGCCAAGACATGGAAAATAATTTGACTTTGGCCTTGAGATCCCTTCCCTACTTCCCAGTGAGGGGAGCATAAAGGGGGTTCCAAGGAAAGGAGAAGAGAAA
TGAGCATTGAAGTTGTTTTTCCTGTTCAGATTTCTCAACTGTCATGTCTTCAGCTATGATATTTTTTCTTCCTCAGTCTATCTCAGATGATGCCCTTCTTCATAGACTAACATTTTACTT
TTTGTTTTTAATTTATTACTAGTCATTGGAAGAGTAGTCTAATGAATACTTGTGTGGCCATCAGCCCTCTTTAAAAAAAACCAATGATATGGTTGTTGCCAGGGGCTAGGGGAAGAGGGA
AAAGGGAGTTGGTCTTTAGTGGGTATAGAGTTTCAGTTTTGCAAGATGAAATAGTTCTAGAGATCTGTTGTACAACAGTGTGAATGTACGTGTCACTACTGTACTGGAAGGTTAAAAGTG
GTGAAGATAGGAAATCTTATGCTATGTGTTTTTACTAGAATTTTAAAAAATATATGATACTTTTTTACTGCAAAACCATCATCTTTGTGTGCCTGAAAGGGCAAATTTCTGCTGACTCAA
TGGTCCCCTCAAGTCACAAAGAGGAGGACCACGGTTCTACTTGAGGTCATAGAAGTGTAAGACAGGATCCCACTAAGCCATCTGAGAACTCCTTTTGGAAAAAAAAGTGCCAAAGAGAAT
CTTGGCCAGAAAGATATTTATTCATACTTTTCCTTGTTTTCTATAGTTAGCTTACAAAAAGTATATTCAACAAGATAAAAGTTGGGAGGGGAATCAGAGAAGGGACAGAGGGAAAGATTG
GGGGAGTGTTAGACCAAAATTACCTGGTGTAGATACACAGTTCTCCTCTGGGCTGGCCTAACTCAAGGGAAAGCATCCGGAGGGTGTCCAGAAGACCAGCTGGGTGGCCTCTTGGGCAAA
GCTCCAGAACCTCAATTTCTCGTAGCGAGCTTCAAGTAGATATGGAGGGGACAGCCAATCTGAGATGTTCTCCCTGGTGTGTTTCTGGAGTCCAACCAGTGAATGCACACAGAGGGGAGA
ACCCGTGCCCACTTGTGACACCTAAGAGGCCTGTCAGGAGTATGGTCTAAACACAGCATCATTCCATCTGCATGCCATGGGCACTTCGCTGGGCTGGAGCTAGACTCTCTCAAAAGATAT
TTTGCTTCTGTTCCACCAAGCCTCACGAACACTCTAAGCCCCAAAGCCCCTCATCAGCAAACAAAGCTGCATGAATTTTAGTTTGATGACTTAGGTTCAGGGTTAAAGCTCACAATGAAG
GGGTTAATCTAAGAGCTGGAATCACTCCAGGTGGCCTGGAACAAGCTGTAGGCTCAGGGGAACCCTGAGCTTTGTCACAACTTCCATTCTTATGCTCCCATCAAATTGGCTCTTCGAGGA
AGGGGGGAAGCCCCTGCTGATTTCTGAAGGGAGGAGCTGAGTGTCTGCTTCTCAGTCACACTCCCCTGATGCAATACATCCGAAGGAGGGAGGGGAACTCCAAAGCCGTGTTCCAGGTTT
GGTAACAGCATTTCTCACATCTGTGACAAGACAGGTGCAGGATCTCAGGTCACAGACTGTCAGGGCAGAAGCAGACATCCTGGGTCACTTGGTCTGACTCCCTCACTTGGCAGGCCAGGC
GCCCAGAGACGTTAAGTAACCTGCCCGATGTCACAGAGCTAGTTATAGCAAACGCAGAAGCACAACTCAGAAACTCCTGACCCCGAAGCCTGAGTTCTTTCCCTTCCAGCACCGCCTCTT
TCCGTGTCTGCCAGTACCTGGCATGGGTCTGCATGGATGGTAGGTGCTTTGTTACTGTGGTTTCCCCTTCTCTGCTCCAATGTGAGGACATCTGCTGTTCCCTGGGCCTTCTCTGCTTTA
CCATCCCCTTTCTGTGACTAAGTCCCTCCCATGCGAGCTCTACAAGGCTCACACATGATCCTGGGTCTCATTTCAGCAATGCGGGTCCTCCTCCATCTCCCAGCCCTTTTAGCTTCCCTG
ACCTTGCTCCAGGCTGCAGCGTCGGCAGCAAATG
GTAAGTGTCTCCCTGTATGGGTTTTCTGGGGCTGCTGTAACAAAGGACCACAAACTGGGTGGCATAAGACAACAGAAATTAAGGGG
CACCTGGGTGACTCGGTTAAGTGGCTGACTCTTGATTTCGGCTCAGGTCATGATATCGGGGTCCTGGGATGGAACCCCACATCGGGCTCCACGCTCAATGGGGAGTCTGCTTCAGGATTC
TCTCTCTCTCTCTCTCTCTGGCCCTCCCCCCACCTCTGGAATAAATGAATCAATCTTAAAAAAAAAAAAGACAACAGAAATTATTTTCCCACAGTTCAGGAGGTAAGAAGTCCAAAACAA
AGGTGTCAGCAGAGTCCTGTTCCACTGAAGGCTCTAGAGAAGAATCCTTCCTTCCCTCTTTTTAGCTTCTGGTGGCTCCAGCAATTCTTGGTACTCCTTGGTACAGCTGCATCAGTCCAA
CCTCTGCCCCTGTCTTCACACACTTCTCTATGTGTATCCTCTCCCCTTGCTGAAAGGCCACCAGTTACTGGATTTAGAGCCCACCCTAATCCCGTACCCTTATGACCTCATCTGAATTAA
TTACATCTGCAAAGACCCTATTTCCAAATAGGGTCACATTCTGAGGTTCTAGCAGGACATGTATTTTGGGGGGGGACACCATTTAACCCACCAGACTTGCCCTGTTCAGAGAATGTGTCC
TGCCCACCATGCTCCAGACCCCAATACAAGTGAAAACAAGAAGCAATCCTACCTCTACCCTATGCCATCCCACCTCTACCCTATGCCATCCCCTTCTCTACTTTGGGGCCCTGATCAGCT
AAGTCCTCTGATGGGCTTAAGCATCTGTCTCACCAAGAACCAGAAAAATCCCCACAGCCCAGTAGCCCGAGCCAACCTGAATGGTCACCCACCTTAATCCCAGCCCTGGGTATTCTAGCA
GACTCCTGGGGAGAAATTTTGACATCTTAGCAAGGCTCAGAGAGTATTCTTCCTATTCTGTGCTTTTTTTTTTCCTTGAGGATTCTTGTGAATGTTTCCTAATCTCAATCTTCTGCCTGC
TCAGATTTGAGGGGTGGGGGTAATGGCTGAGAAAGAGGGAGACAGAAGCGGAGGGTATCTCGAAGGAATGGTGTCAGACGCTCTGTTCCTTGCCCCTCCGCCTCCAAGCACCACCCACCA
CGACTGCTGCCATCTCCGACGCTGTGAGTCAGGTCAAGGTCCAAGTCAACAAGGCCTTCCTGGAATCCCGGACCAG
GTACGTGAGAGGTGCACACAGCCTACCGCCCCTCCTAGGCTTCC
TGGTAGTGACAAGCACACCGGGCTGGCCTGAAAAGCCCCGGGCAAAGCAGTTGTAAGAGCTGCACCGCCGCCTCCCCACCTCCTCGGCTCACCGCATGGGGCAAGGAGAAATAATAGCTC
ACGAGTCCTAAAAATCCTGAGTCTGTAAGTCACCTTGAAGAGAATGTCTGATCTAACCCTATAAGTACGTTCTTCCACGTGGCCAAATGTTTCCCTGGGTCATGCATTCCAGAGTCTCAG
AAAGCTTGTAGGTACAATTTCTCCATTCCTTCAACTAATATTGACTGACGTCAGTCCGGTTCCCTGGGAGCAGAATCTGAGAAGTGGACTCACGTGCAGGTGGCTTATGAAGGCGTGCTC
TCAGGAAAGCCGTGGATCAAGTGAGGGGACGAGACGGAGAGGTCAAAGGAAGAAGTGGAGCAAGGATTGGCTCAGTAATCACACCAGAAGGGTTCAGCTGTGAGCCTTCAGCAGCTGCAT
CCAGGGTGGCTAGGGCTGCAGCACCCCAGCCCCATAAAATGATCCAAGGGTGCTTGGGGACCCCACGGGGTACCAGCAGAGTGAGCCCCCCTCCAACCACATGAGGGGCTGGGATCTCTG
AAATAAGCAACGCAGAGCGGGTCCCTGCCCTCAGGAAGCTCGCCCAGCTAAAGGCAGACAAACAAGAATAGCCATTGTGTTGAGCAGAAAGCAACCTTATTCCTTCCTCTTGCCGTCCCT
TTGTGCTAGAACTGGGGCTTCCTTCCTCCTTGGCCTTTGAATATACTCCCAAGCAGTCCCAGAACTGTTCTGCTGACTTTTAGATGACAACATGTGCTCTGGTCACTTCTAGGCCCAAGA
ACAGTGTCCTTTCAGGAATTCAAATGTCAGCAGCGTAAGGAGACCGAGCCCAGAGCTTCTCACGTCCCTCAGCTCAGAGCTGCATTAGGCTTACAGTGAGAGAGGGAGCACGGTCTGCTC
ATCCCTCTTTCCTGGGCTCCTCCCTCTCCCCCAAGCACAGGTTTCTGACTCCGTAGGGGTTAAGTTGGGGAAGGGAGGAGAGATGCCAGAGGCAAGGTCTAAGTCAGCTCACAACTTAGT
GCCTTGGGGGAGTCAGAAGCTCTTCCCCACCTCGGGGCACTTGTCAGCTCTCTTGGAGATTCTGCTGCAGCTCCCTGACCCAGAGAAGTTTCTGGCCAGTAGCTTACAGCTCCAACCCTC
AGCCCAGAAGCATCTGGCTCACTGTCTCACCTCCCCGCACCCTCCTGAGTCAGGTCCCTTTTCAGCAGGCTCCAGAAGACTAAAGGCTTTGCCCCGCTGCCAGAGGATGTGTGGATCTTG
CCCAGGGCTGCCCTGTCTGGCTCACTCTCTCAGGTGCATAGTCCAGCCACCACTTCTTGAGGCTCTTTGGGCAGGTATCAACCACTGGCCATGACTCTAGGACACACAGTCAGGCCCTCC
TCTTGAGGTCCTTGTCACCAGAATTAATGCACAGAGGAAGCCCCATGGTGGCAGCAGGGAAGTGCCTGGGACTTCAGCAACCATCTCCAAATGAACATTCTCTCTCCCTCCTTAACTTCA
ATCCTTGTATAGCCCCAAGGTGGGGATAGAGTAAAAGCCAGTAAAAGCCACAAAATCAGGGTTCCTCACCTCCTTTGCAAGTTGTGCACAGGATGACCAGGGCTGCTTTGAGATTCATCC
CCACTGGTTAGTTCTTGGACTCGGGGACCTCATGGAGACATAAAGAATCACACAGAAACATCTCCTTACATGAACACAATCCAAGGAGTCATGATTTATGAAAAGGACAATGAGGGAAAT
ACACAGAGCAACGGTTGCTACTCTAGGTCAGGGATCAGGGAAGCCTGCTGAAGATGAGAAGCAGCCAGCCATGTAGAGAGCCAGCGGGATAGCATCCCAGGGGCTGGGAGGGGCAAAGGT
GCTAAGGCAGCAAAGAGGCTTGGGGGGCTAAGAAGGCCAATGCTGGTGGGGGTGGTTGGCAAGGAGGAGCGCATACTGGTGAGAGAGAGAGGTGGGTCCTGAGGGCCATAGAGTCAGAAA
GCAGATTAGTGGTTGCTGGAGGGAGAGGGGGAGCAGGGGAGGAATTGGAAGTGACCCCAATGTTTGGGAGCTAGACAGAGGCAGTGGGGGCGTGACATTCGGAGCACGTGTGCAGTAAGC
AGGTGGTTCAGCCCTGTCCCGGGGTAAGCCAATGAAGGGCTTTACCACGCAGAGCGCCAGGGTCTGCTTTTCCTTCTAAAAAGTTCACTGCAGCAGCTGCGTGGGGACGGACAGGAGACG
GGGAGGGGGATGGGAGCAGGGGCAGGAGGCTGCTGCAGCCGTCCAGATGGGACATGATGGTGGCCAGGGTGAGGGTGCAGTCATGGAGGTCGATAGACTTCTTTCCAAACCCTGACTGCC
CCACAGAGCCCAGCCCTGAGCAAAGTAGGAGACAAGTCCCTTGGGGGGTCTGCCCTCAGGCAGGAGGGCTACGCAGAGCTCAGGGCAGAGGAGGCGGGAAGAGCACGGAGAACCTTGCAT
GGGACCTTCCCGGTGGAGCCCTCCAAGGCCCAGCACCCGACCTTATTTCTGGGGTGGGGGTTCCCTTTGGGTTCTGGCTCATGAGGTTGATGGCGCTGATGCCAACACACGTGAGCATTT
ATTCTATGTCTGAAACAGGTCCGGGCACTTTACACTCCCTCCTCCCCACAGCCCTACGAAGAGCTCATTCGACCTATATGAAGTCGCTTGTTGTTGAGGTCAAAATGATTAAATAGCGTG
GTTCAGCCCAAGGTTACTGTCATTATCCTCATTTATGGATAAGGAAGCTGGGTACAGAGAGGTTGAGTAACTTGCCCAGAGGCACACAATTAGTTTAGTGGCAGGCATCAAAACAGGAGT
CAGAACAGCCAGAGTTCAACTCTTGTTTCATAAGCTCAAACTCTAGGCCAGTGCTGGCCAATAGAACGTTCTGTGATGATGAAACGTTCTATATCGGTGCCGTTCAATACAGGAGCCATG
AACTACATGTGGCTCCTGAGCACTTAAAATGTGGCTAGTGCCGTGAGGAACTGAATGTAACTTCATTTTAATGAAGTTCCATTTAAATAGTTACACGTGGCCAGCGGTTACCATATTGCA
CAGGGCGACACTCTGGGCCACGGGGCCAGGCCGTCTCTGCCACAGCAGCCAAAAGACAGTCGGGTTTCTTTTCTTAGGTTCTTTTTTAATTGAGGTTGGGGGAGGCTGGTCAGGGTAAGG
CCTGCTATTAGGGCCCAGTCATCACAGTTGTCCTTGTGCCTGTCCTGCGTGCCCAGGAAGTCCCTCGACTGAGACACCATGCCCCCCATTCTTGAAATAGGTAAGAACCTGATCCATAGT
GACAGCTCAGGTATTGCGACCAGTGAGCTGTCCCCCCAAAACCAGAGCCGTCTTTTGTGAGAATCTGAGCCACTTCCAAAATCTCAGAGTCTTAGAGCCATAGACATCCTCTCACAGAAC
CCTTCCTCTCCCACCTGAGGGGACTGAGGCCCAGGAAGGGGGTGGTGGATTCTCACGGAGGGACTTTCCTGACCCCACCTTGCACTCAGTCACCTCTGTGTGTCACAAACTTCTTAGTTT
GTGCAGGGATTTGGGCTTCTCATTTTATACATTTACACATGGGAAATTAAGAATAAAAAGGCTGAACATCGTGCCCCAAAAATGGTCCACAAGAGGCCGGATGCTACAGCCCACATCCAA
ACAAACTCCACACACCCCTAGGGCTACATGCAATTGAGGATGTTTCCATGGGAAGAACTACAGGCCCGTAGGCTTGTTAGTCCTAGAATTCTCCGTCCACACGGTTTGATGAGATGTCAG
CTACATGGGCAGGTGTTCCTCAGTCTGAATCAGTACATCTGGGCTTGGGTGCTTTTAAGTTTCCCCCACTGAGTCTGACCCAGCCAGCCCGGCTACAACCCTCTGCCTCTGATTCAGGAA
GCGCTCACCTCCATTGGTCTGCCCTTTCTCAGAACCGGACACACTCAGAGCACACTGTAACTTCCTCCTCCCAGAAGAGATTTTCCAGAGGCATCCGAAGGGAAATGAGAAAAGAGCACA
GGGAGTGCTTGTCTCCTGCATGCTGCCCACACCCCCTGTGTCTCCTCCCCAGACACACATCCCCTCACACCCCTTCTCCAGGGTCGGACTCGAGGGGCCAGCTCATGACTCTCCCATTGC
TCTCCGCCGTAGGCTGAAGACGGCCATGAGCTCTGAGGAGCCCACCACGCGACAGCTCTCGGAATACTTCAAGCATGCCCGAGGCCGGGCGCGCACAGCCATCCGCAATGGGCAGGTGTG
GGAGGAGTCCTTAAAGAGACTGAGGCAGAAAGTGGCCTTGACCAATGTCACAG
GTACGGAAAACCCACTGACCCTCTGATGGCAGGAAGGGGCCATCTCTCTGCAGGAGAGAGCAGGACA
CACCAATAGCTGCATTCCCTATTAGGGGCACCTCGCAGGAGGGACCCTCCCGGCTTCTCAGGGCCGTGTATCTGCAGAGCGAGGAGGGGCAGAGAAGACAGCTATGCCAGTGTGGGGGTG
TGTTTTGCCAAGAAAGGAATGCAGGCCCAGCACGGTCACGTTGCCAACTCCAGATGAGGGGACATTCATGCTCTTCGTATAATGCCATCTGTAAGGCCTCTGTTCAGAGGAAGTGCTAAA
GTCAATAAACATGAGCTCCCTGTCCCAAACCACGGAGCCACCATTACAGTCTATAAAGGAGACATTTAAGCCACCTGTATCAGGGGATTTACTGGGATTATGTCACAGGAGATGAGATTT
CCATCTTGTTTGGGGTAATGTGGAGCTGAAACAATGAGGTAATGGATTGATCATGACCTCCTCCAACCCGTCCACTGCCCCCCCCGCCCCCGCCACCGGCCAAATGTCATAGCTCTTCAA
GGGTTTTGTCCCGACCAGAAAAGAGCCTGCAGGTTCTCCCTGGGAAAACATCCAGTCCGGGAAGGTAACTGGCCTAGGACTTGGGCAAATTCCAAAGTTCCAAAAGAAGAAAACTGGGAC
AAGGTGGGGAGAAGTAGGAATCGCTTTGAGACTCTGAGGTTCCCTTGCCTCCCTCCCATGCAGGCACCAGGATGCACCATGGGCTGCATTAGGAGGTTAGCGGTTCCCTCCATTCCGTGC
CTCGCATGCCTGAAGCCCCCCTTTATGTTACTTCTCCCAAGAGCTCAGGGCTGCTCACTTGAAAATTCCCTATCCCTTCCCAACATCTTCCTTATCTAGATTCCTGCTTGCTTGGTACTT
TAGATGTCAGTGGAGCTTTAGAAGAAAAGCGGTTTTATCAAACAAATTCATAATAACAGGTGCTCGACCTCTCAGGGGCATTTTCATTCTAAAAGAAAGATCTGTTGATTCGAATGACCT
GCTAAATAAAGAATCATTAACAGTTCTGGGGAGTTTCACAATAACTATCTGTGTGGCCTCGGGCAAGTCTCTTGAGCACTGTGGCCTCAGTTTCTTATTTGTAAAATGGGAATTAAAATT
CCACTTTAATGAGTTGTCAGGATGAACAAGAAACCACCTGACAGTTCCTTCCCTAGAACATAAACATGTATTCTAAGAAATGTAGGTTCACCTCTGGTTTCGGTGTCCTGCCTCCCCCAA
GTGCCCCAGAATGGAGAAAGAACTCAGCCGCTTGGTGTCCCTTCTGTTTCAGACCCCAGTCTGGACTTGACTGCACTGTCTTCGGAGGTGGGTTGCGATGCCCCTGTTGCTGTGGTGAAA
TGTGACGAGGACAGTCCTTACCGAACCATTACAGGAGACTGTAATAACAG
GTGCGTGGGCATGGGCAGGTGTGGGGGACAGCCCCTCCCGATGGCCATGCCCAGCCCACCCGCTCCTGCT
CTGCCCAACCCAGCCCAGCCGGGGGTTTGGCCGCTTGGGCGTTCCAGGCAGAGCCCCCACTGCCTGACCCTCCTGGGCCTGCGGCCCCCTGGAAACCGTCCTATTGGAACCCTCCCCCGA
ACTCCCCCATCTTCTAAAAGGGCCCCTGTATCCCACCGGCAGCGCAGCCCCGCGCCTTCAGGGCGGACGCAGTTCAGAAACCCCACATTCGAGAGGCCTCTCCTCCGCGCCCCGTTTCCC
GCGGAAGGCTCCGACTGCTGCCGCACCGGGCTCCACCAGGCAGCCGAGCCCGCAGCGGCCGGGCCGAGGCTGAGCGCGGGTCTTGCTCGGTTTCAGGAGGAACCCCGCCCTGGGCGCCGC
CAACAGGGCGCTGGCGCGCTGGCTGCCCGCCGAGTACGAGGACCGGCTCTCCCTGCCCTTCGGCTGGACGCCGGGGAGGACGCGGAACGGCTTCCCCGTCCCGCTG
GTGAGGGCGCGCCC
GGGGTGGGCGGGAGCCCGGAGCACCAGGGGCCGGCAGGGCAGCCAGTGGGGCGCGGATACGCCCCCAAACACACGTGGAAAGGAAGGAGAAAGGTGGAGGGCAGAGGGTGCGAGGCGGGG
CCGCAGCGGGGAGATGGAGATTTGGATTGGCTCCCCGGTCGTGGTCTCCAAAGTGCCACCAGAGGGCAGCAGAGCCCGGAGCCCGGAGCCCAGCCACGGGGTGGTCGCATCCGGGCTGCC
CACAGGCCAGATACTCTGGGGTGTCCCGGGCAGATGGCCTCCCTGCCCCATCCTGCCCGCGCCTGCCCCGCCCCCGCCCCTGGGGTGCATCAGCTGTTGCTTGCCCGGAGGTCCTATCTG
TGCGCCTCATCGGAGTTGGCAGCCCCTCCCCAGAGCCCCTCTCCTATTGCCAGACACCTGGCACCTCAGTGACACTTCAGGAGCCTTTGTTTTCCCTTTCCATAGTGAAAAGGGCACTGG
CCTGGCAAGCCATCAAGTCACACACACCCGTGTTCAGGCCCACCCCTACCCCTTCGTATCTGCAGGACTGCTGGGAATTGGCCTTGCCTCTGCAGGACTTAGTGTCCTCGCCTACAGGAT
AGGTGTAATGCCACCCACCTCACAAACTTGTCATGGGGATTAAATGTACCGGTCATACCCGAGGTACACAGCAAGCTGCATTTGGCTCTGCTCCTCAAAGCACTTCTTCCTCCAATCCTT
CCTCCCCTTCTCTCTCTGCCCACAGGCCCGCGAGGTATCCAACCAGATCCTAGACTACCTGAATGAGGAGGGTGTTCTGGACCAAAACAGGTCCTTGCTCTTCATGCAGTGGGGTCAAAT
TGTGGACCATGACCTGGACTTTGCCCCCGACACCGAGCTGGGGAGCAGCGAGTACTCCAAAGCACAGTGTGACAAGTACTGTCTCCAGGGAGACAACTGCTTCCCCATCATG
GTAGGCCC
CTCCAGCTGTCTGTGACAACCCTCCCGCCTCCCTGCCGGAGCAGACATTCCCAGCTGATCAGCCAGGTGCCCAGGATAGCTCTCCAATGCTGATTTGATGGCTTCCCAAACCTCACACAC
CCATTCATTCACCCATCCATTTAGTCCACAAATAGACATTAATTATCAACTCCATGCCAGGCAGCGTACTAAGCACTGGGGATCCAAACACTGTTCTTTTCCTCAAAGACCAAGAGCCTC
TGTGGGAAATGGACAAGGAAGCACTAAATGGCAAAATTGGGGGAGCTCTGGGGAGGGTCGTCTCCGTGCCTGGCCCAGGGGCATTGGCATCACCTGGGGACTTATTAGGAGAGCAACATC
TCAAGCCTCATCCCAGACATGAGGAAGCAAAGTCTACATTATACCAGAATCCCCAGGAGATTCTTTTTACACACAGTGAAGTTTGTAGCACACTGCTGGACATCACCGTGGGGTCTGGGA
AGGCTACTCCCAGAAAGAGCTGCGATTTGATGGATGAATCCGAGTGAGGCAGGGATTTGTGGGGCTTTCCAGAGGGAAGAGAGGAATTTGCCATGGTGGCCCATTTTCTTCTTATTCATG
GATTTTACAGTTAGAGAGTGATTTATTCACTCGAATCAAGGCTATGTGCTGTGGTATGAAGAACATAAGCTGTGGACTGAGGTCAATCTAGATCGGAATCCCATATGTTTCCCTTCCAGT
TTCTAAGTTCTTAGGCAAATTACTTAACTTTTCTGAGCCTCAGTTTTCTCACCTGTAAAATGGGACTGAATTATCTACCTGACAGTTTTTGAGGACCAAAGTGAGATAAGGTATGCATAA
TATATAGCACATGTTAGGTCCAAAATAAATGAATGGTAGCTGTTGTTAGTAGTGATTATTAACAGAGCCTTTCCTAGCTCATGTCCTGCTTCCCAGGGCAGGGATCTCAGGACTCCCTCC
CCACCAAAAATGTGGCACCTTTGCTATGAAAGATTGAATAATTCCCCTCAGCCTTTTTATACAGTGGGATGTAATGAACTTCAGGACATTGTGGCCCAGGGCGTACAGCGTCAGCAGGAG
GCATCTGGAGTCAGTATCTGGTCCCAGGGTCCCAGGAGGGCTCCATCAGCATCTTTGCTGGCTGCATCCAGACCCGCCTTGGGGAGAGGTTGCCAAGTCCCAGCTGTACCACCTCTGCAC
GGTCACCTACCCCCCAATCTCTCCACAGTTCCCTCCCAATGACCCTAAGTTGAGGACTCAAGGCAAGTGCATGCCTTTCTTCCGAGCTGGGTTCGTCTGCCCCTCTCCACCTTACCGGTC
CCTGGCTCGAGATCAGATCAACGCTCTGACCTCCTTCCTGGATGCCAGCTTCGTATACGGCCCCGAGCCCAGCCTGGCCAGCCGCCTTCGCAACCTCAGCAGCCCACTGGGCCTCATGGC
TGTGAACCAGGAGGTCTATGACCACGGGCTGGCTTACCTGCCCTTTGACATCAAGAAGCCAAGCCCCTGTGAGTTCATCAACACCACCGCCCTAGTGCCCTGTTTCCTGGCAG
GTGAGTC
TAGGCTGGGAACAGAGGGACCGAAGGACTGGGAGCAGAGAGAGACCAAAAAAGTACTAGGCAGCTTCCAAGGAGGCTTTGCCACTGCCTCTTCTCCTGTGCCTTCTGGAAAAAAATGCAC
ACCAAGCCCCCACTGCCTCTGGCGCTGGTCCAGGACTGGCAGAAAGGCCCAGATGAATACAAAATCTAAGAACATGTGTTCTTAGAAAAACATGATAAAAAAAAATTCAGTGCAGAGAAG
CACAAATAAGAAAATCCACAAAACCCCGCCACCCACAGATAATCATTAACATTTTTAATGCCCGTTTTTCCAGGTTTTTAAAAAAAAATCTTAGATATAGTTCTACACTGTTTTACACAA
TTGGGGTTATACTATCAGTTATGTTCTATAACCTGATGTCTTCATTTAATATATCACATCATGAATTATTCCTCTACAACATGATTTTTACTGGCTGCCTGGTATTCCATGACATATATT
ATCATAATTTATTTTATCGACCCTACTTGGAAGTATTTAAATCATTTCTAGTTTTTCTGCGATTTATTGCTGTTTTTTAGGTAATGAACATCCTTGTTGATGAATCTTTGCACTGATTTT
TAATGATTTTATTTTTTTAATTTTTTATTTATTTTTTTAAAGATTTTATTTATTTATTTGAGAGAGACAGAGAGAGCACAAGCAGGGGAAAGGGACAGAGGGAGAAGCAGGCTCTCTGCT
GAGCAGGGAGCGCAATGCAGGACTCGATCCCAGGACCCTGGGATCATGACCTGAGCTAAAGGCAGCCGCTTAACTGACTGAGCCACCCAGGCGCCCCTCGTTTTTAATAATTTTATGAAG
ATAACTTGCTAGAGGAGGAAGTTCTAGATTAAGAGGAATGCCTATTTTTAAGGCTTTTTATTCTCTCAGCAAATCCCCCCCCCATAAACCTGTGCACAACCAAAGCCCCCCAATTCTGTT
CATTCCAGGGGCCCATGCCCCCCTGATCTGCCCTCAGGCCCTCTGCCTTGGGCTTCTGGAGACCTCTCCTCTTCCAAAACTCCACTCTGCGGGACAAACCCACTGCCCACCCAGACGTGG
CAGAAAGCCAGTCCACAGGCCCAGACCTCTTGGGTGGATCTCTTGGATTCCGTGTTCACACGTATCTCACATCAATCCAGTTACAAGACCTAACCCTTTCCTGTTTTCCACAAAAATATC
TGCAAAGATCAAGCGTTTGTGAATTTAACAGACTTTTCCTGAAGATTAGAGGACACAAAGTTTCCCCTTGTGAAACACCTGCTCTTCTTCCAGTTAACTAACCCCCACCATCCTGTGCCT
CCCCTCTTTCCTTTCTCCCAGCAGCCCCATCTCTCGATTCTTCTCCCATTATTGGATGGAGAAATTCTACCCTACCCACGTGCCTGCCCTCAAACCTGCATTCCTAAAGCTTTCGAAGTT
GCTCCACACAAAAAGCCCCTGTTAATTTGTACCACCCCATTTTAGAGGGCAGTTGGGGTTGTAATTAGCAAAATTTTACTTTTCAATGTCATCTGCAGTTTTTAGCACAATCTTGTGCGG
TCCGCCTTATTATCCCCATTCTCAGAGACTGAGGCTTAGAAGTGCCAAGTAACTTGTCCAAAGTGACTCAGCTAAAAATCGTGTGTGTGAAGCTGAGATTGAAACCTATGAATCCCCACC
CCAATCCCTTTTTCCACTTGACTTCCCTTAGGTTAACTGGAAGGAGGGGCTTAGGAGAGGGTCCCTCAGGGGCACTACTATCTATTTCTTTGTGCAGGTTACTGGGTTCTGGGGGCTGCT
CCAGGGAACCAACCTTCCTGCCTTCTGGGCTTTCAGGAGATTCCCGAGCCTCTGAGCAGATCTTGCTGGCCACTTCCCACACCCTCTTTCTCCGAGAGCACAACCGGCTGGCCAGAGAGC
TAAAGAGACTCAACCCTCAGTGGGATGGAGAGAAGCTCTACCAGGAAGCCCGGAAGATCCTGGGAGCCTTCGTGCAG
GTACGGAAGCCCAGGAGCACTGCCTCCCACGCCCACCTGGCCA
CAGCCCCTGGCTCTGCCCCCTTCTCCGTTTCCCCACCTCCACTTCCCCTTCTCTGCCTCTGCTGTTTCTTTCCCCCCCTCCCTTTCGTGTCTTTAGTTCCTCTGCCCCAAAATGAATCCC
CGGATTCAGAGTGCCGGAGAGTCATGTTATGTCACTCAGGTGCCATCACTGGGGCCAAAGTCTCTGTCACTCCTGGGACTGTCACTCAGCATCTAGGTGGGTTATTTCAATTGGAATCTC
TTCTTTTTAAGGTCTTCACACCCAAGTCACAGGTTACAAGCATTGTCCATTGCTATAGTAGGTTGGCTGATTGACTAGCTAGAATTAACTGGGCATGTATTTAAGCATTTTTTTTTAAAG
TTTGGGGACCTTTTTTTTTTTTAAGATTTTATTTATTCATTTGACAGAGAAAGAGACAGCGAGAGTAGGAACACAAGCAGGGGATGTGGGAGAGGGAGAAGCAAGCTTCCTGCCGAGCAG
GGAGCCCGATGCTGGTCTCAATCCCAAGACCCTGGGATCATGACCTGAGCTGAAGGCAGACACTTAACGACTGAGCCACCCAGGTGCCCCATTTTTTTGAAATAAGTACAGATTCTTAGG
AAGTTGTAAGCCAACAGCGCATGCACCCAGCCTCCCCCAGTGCTGACGTTTTCCATGACCATGGTACAACATCAAAAACAGGACACTAACATTGACACAAACCAAAGGTCTTATTCAGAT
TTCACCAGTTAGAAATGCAATTGTGTGTGTGCACGTGTGTGTGTGTCTGTCTGTGCAATTTTATCACATGGGTAGTTTCATGTAATCACCACCACAATAAAGATACTTCACTCAACCATC
ACCACAAGACTCCCTCCTGCTACCCTCTGACAGCCACACCCACCTGCCCCCTTCCAGGTCCGTATCCCCTGGCAATCATTCATCTGCTCTCCATCTGCACAGTTATATTATTTCGTGAAT
GTTCCATAGATGAAACCATGCAGTATGTATCCTTTCGAGATTGGCTCTTTACATTTGGCGTAATTGCCATGAGGTCCATCCAGGCTGTTGCAGGTGTGAAGTCCCTTCCTTTTCGTTGCT
GAGTAGTGTTCCATGGTTGACTTAACCATTCACCCATTGAAGGACATTTGAATTGTTTCCAGTTTGGGGCTTTTAGGAATGAAGTTGTTGTGCACATTTGTGTATACGTTTCTACACAAA
AGTAATTGTTCTTTCTGTGGGATATATGCCCACAAGTGAAATTGCTGAGTCATATTGAGGGTCCATTTTTAGTCTTAAAAGGAACTGCCCGTCTCTTTTCCAGAGTAGCTGGGCCGTGTT
CTGTTCCTGCCAGCCATGAGTGAATGATCCAATGTCTGCAGCCCGGCCATTATTTGTTGCCATCAGTGTTTTTTCTTTTACCCTTTCTGAAAGGTATATAGGGACATTTCATTGTGGTTT
CAATTTACATTTCTCTAATGGCTATTCATGTTGACCATCTTTTCCTGTGCTTATTTGCCATCTGTATATCCTCTTTGGTAAAATACCTGTTCATAGGTTTTGCCCATTTTCAAATGGATT
ATCTTTTTTTTTAAATTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTGGCAGAGAGAGAGAGACAGCTAGAGAGAGAGGGAACACAGCAG
GGGGAGTGGGAAAGGAAGAAGCAGGCTCCCAGCAGAGCATGGAGTCTGACGTCGGGCTCGATCCCAGAACCCTGGGATCATGCCCTGAGCCAAAGGCAGACGCTTAACGACTGAGCCACC
CAGGCGCCCCTCAAATGGATTATCTTTTAATGTTAAGTTTTGAGGGTTCTGTACATATTCTAGATAACAAATCCTCTGTCACATACGTGACTCATAAATATTTTCTCCCAATCTCTCTTT
CTCTTAACAGGATCTGTTGCAGGGTAAGAATTTTTAATGGTGATGAAATCCAATTAATCCTTTTTTTTCTTTCTCTTTGGTGTTCATTTATAGATAATGTGTCATTTCTCTTTGGTAATA
TTTAAGATTTTTGTGTTTATTTTTCAGAAATTCAGTGATAATGCATCTCAGAGTAGACTTCTTTGGATTTATTATGTTTGGGAGTCTTTGCTGGGTTGTGCTTTTGGTGTCAAGTCTCAG
AACTCTTTCTCTGGTCCCAGATCTCAAACATTTTTCTCTGGTTTTTCCTAGAGGCTTTATAATTTTATGTTTTCCAATTAAGTCCATGATCTATTGGGGGTTAATTTTTGTATAAAGTGT
GAGGTGTAGGGTGAGGCTCATTTTCTTTGGCCTATGGATGTCCAATTGCTCCAGCGTCATTTTTTTGAAAAGGCTATCTCTCCTCTATTAAATTGCTTTTGCTCCTTTATCAAAAAGTGT
TTGTGCATTTTTATGTGAATTTATTTCTGAATTATCAATTCTATTCCATTAATCTATGTGTCTATTTCTATATCAGCACCACAGTGTTTACTGTGGCTATCCAGTAGGACTTACCATGGG
GAGCCACAATTCTTCCAACTTTATCCTTTTTCCAAATTGTTCTGACTATTCTAGGTCTGTCCCTTTACTATATATTTTAAAATAAGCTTATCTACGTCTACCAAAAAAAACCAACAACAA
CAAAACAAAACAAAACAAAAAAACCTTGTTGAGATTTTGATAGGAATTGCATTAAAATTTAGGGAGAATTGACAGTTTTATTATGTTGAGTTTTCCAATCTATACATGCAGTATGTCTAA
GTGTTCAGGTTTTCTTTGCTATACTTCCCCAGCATTTGGTAATTTTTATCATACAGATCCTGTACATGCTTTGTTATATTTATACCTGAATATTTTATTTTCTTTGGAGGAGTCATAAAT
GGTATTACTTTTTTTTTTTTTTACTTAGCTTCCACTTGTTCTTTATCAATGCATGAAAATACGATTGATTTTTGTATGTCGATTCTGTATCGTGGCCTTGCTGAATTCAGACAGTTCTGG
GAGTTCTTCTCTGGAGTCCTTAGGATTTTCCACACAGAGAATCATGTCATCTGCAAATAAAGACAGTTGTGTCTCTCCTGTTGTAATCTATATATTTTTAAAAATTTCTCTCTCTCGCCC
TGTTTCAGTGGCTATAATTTCCAGTGTTGTGTTGCATAAAAGTGGTGAGAACAGACATCCTCGTCTTCCCAATCTTAGAGGGAAAGCATTCTATCTTTCACCATCAAGTATAATGTTGGT
TGTAAATCTTCTGTGAATGCTTTATGAGGTTGAGGAAGTTCTGCTGTGTTCCTAGTGTAAGGAGAGTGTTTTTCATGAATAGATGCTGAATCCTGTCAAATGGTCTTTCTTCATTAATGC
GACTTTTCTTCTTTAGCCTATTCCGCTTGCTTCGGGTTTATTTTGCTCTTCCCTCTGGTTTCTTCCAGCACTTGGAAAATGCCGTGCCCCTTTCTTCTGGCCTCCATGGTTTCAGATGAG
AAGCTCCCCATTATTCACATTTTTGTTCATTTATAGATAATGTGTCATTTTTCTTTGGCAATATTTGAGACTTTTGTGTTTAGTTTTCAGAAATTTAATTATAGTGCATCTTGGAGTAGA
TTTCTTTGGGTTTGTTATGTTTGGTATTCATTCATCCTCTTGAATCTGTAAGTGTATGTATTTCATCAATTTTGGGAAGTTTCCAGGCATTATTTCTTCAAATACTTTCTCAGGCCCACG
CCTTCTCTATTTTTGGGATTCCATCAATATGAATGTTAGATCTTTTGTTATTGTCCCGTAGAGCCCCGAGGTTCTGGCTTGATTGAGGTGTTTGTTTTGTTTATTTTCTCTCTATCACTT
AGGTTGAGTAAATTCTATTGATCTGCCTTCATTTCCACTCTGTCATCTCCACACTCCTGCTGGGTCTTCCGAACAAGTTTTTAATTTTAGTTTGTATTTTTCAGTTCTATCATTTCAATG
TTTCTTTTTTATAAATTCTATTTCTTTGCTGAGATGGTCTGTTTTTTGTTTCAAGGTAACATAGTGGATTGTTGAAGCATTTTTATGAAACTGCTTTAAAATCTTTATCACATAACCTCA
GCATCTGATTCATGTATTTATTGGCATCAGTTGACTGTCTTTTCCCACAAACTGTGGCTTTCCTGGTTCTTGGTGTTATTAGTGATTTTCAATTATATCCTAGACATTTTATTTTATTTT
TTTTAAAGATTTTATTTTTTATTTATGTGACAGAGAGACAGCCAGCGAGAGAGGGAACACAGCAGGGGGAGTGGGAGAGGAAGAAGCAGGCTCCCAGCGGAGGAGCCCGATGTGGGGCTC
GATCCGGGAACACCGGGATCACGCCCTGAGCCGAAGGCAGACGCTTAATGACTGCGCTACGCAGGCATATCCTAGACATTTTAGTTATTGCATTAGGAGACTCGTGATCCTATGTAAGTC
TGTTTGGGTTTAACATGTAGGTCTGGCATTCTTTTGTGGGCTTTCGTTCCAATGAGAGTTTAGTTTCCCGAGCCCTTGCAATGCTATTCTGGTCTGCTTCATTCTTCCGGTGCTCCTAGG
GTTCCCACTCAGTGCCTACTGATGCTGTCTGCAAGGCAGGAAGGCACTTTCCTGGCTGCCTTCTGTTGTAGGACGTCATCCAAATAATGAAACGTATCTACCTAAAGATGATCTGAATTA
AAGTTTTATATTAGTTTGTTCAGGCTGCCACAATAAAATATCATACACTGGGGGGCTTAAATGACAGAAATTTATTTTCTCCCAGTTCTGGAGTCTGGAAGTCCAAGACGAATGTGTCAG
CAGGTTTGGTTTCTCCTGAGGCTTCTCTCTTTGGTGTGCAAATGGCTGCCTTCCCTCTGTGTCCTCACATGGTCTTCCCTCTGTGTGTGAGCCTCCCTGGTGTCTCTCTCTCTTCTTATA
AGGACACCAGCCCTATTGGATGAGGGCCCCACCCTTATGACCTTGTTTAACCTCAATTACCTCTTTATAGGCCCTATGTCCAAATATAGTCATATTCGGGGTTAGGGCTTCAACATATAA
CTTTGCTAGAGGACACAATTCCATCCTTAACAAGGCTTATTGGACTCCAAGAAAAAGAAATCCATTCAGGCTAATTCAGATGTTTAGTATTAGTTCAATCCTATACATATGTCAGATGGA
AGCTGATAAAGGTTTCTTCTGGAACCCCAGGGCAGGGAGTGTAGTTGGGCCTAAGCAAGGGTTAGAGCCAGAGACTGGAAACCATCTGGAATTAGGGCAGCTACTTTCACTCTGCCTCTC
TTTCTCCATGCCTTTCTCCACTTCTCTATTGTTCTCCACTCTCTTGTCTCTCTCTTTTTCTCTGTCTTTGTCTTCAGATGGGTTTTCTCTGCTTTTCTGCACATGATAGCAAATGATCCC
CCACATGGCCCCACCTGTCCCCTCAGATCAAGTGCCATCAAACAGTCTAGGACAGTTGCATCCAAAATCTAAATTCCTGAGAGCGAGTATCTGACTAACCAGCTTGGTCTGGTGCCCCAG
CTGGGCCAGTCCACTACGGCCAGAGGCAAGTTTCTGTCTCTTGCTGCCTCACAGAGTCTGAGAAGCAGGCTGCCTGCTCCAAGGATGAAATCCCCACAGCCTATGCTGCCGAACAAATTG
GAAGCAACCTAAAAGTAAAACAATAAGAGAAGGATCCATGAATGCAATAGAATATTATGCACATTTAATTACATAATAATTGTGAGCTAGGTAGAAACATGAGAAACTTGAAGCAAAAAA
GCAAAATACAGAAGTATGTTTTCTCTAGTATTACAAGTGTGTAAAAATATGTATTGTATAGACAAAGATTAGAAAAAAGAAAAAATTCACATAATTATTGCATTACGTGGTGTCATGATT
TTTTTCTTTTTTCAAATTTTTCTCTAAGTGTGTTAGCTCATTGCTTTGAGTAAAACGAACTGCTCTCTCTATGGTACATCATTTGTCCCAGAGTTGGAGATGAGGTGAACTTACCCTGTG
AACCATTCCTGTGGTTCATCATTCCTTTGGCCCTGGTCCTATGGTGAAAAGTTGAAAGATGTGACATCATTATGTTCAAGTGACACACAAGGACTGTCACTTTAGCTTCAAGGTCATAGA
CCTGGAGTGGAGATGACAAAGAGAGTACATGTCTAGTGCTGATTCAAATGACTGATCAGTAGGGCCCATGTTGAGGCAAATGATGAGTGACCAGCAGAAAGAATGTCATGATCAATTAGC
AACTGCCTGCCATGGTCACGGGAAGGGAAATGGGCATATATGCTATCCATTTGCCCTCCTAGATTTTTGGCTCTCATCCCTCTTGACCACAGCTTCCTCCAACCTCACTCTGCAGAGGTC
TAAGTGTTCTTCCATCCTTTGCTCATGACATGTTTCTCCCCCCAGATTATCACCTTTAGGGACTACCTACCCATTGTGCTCGGTGATGACATGCAGAAATGGATCCCTCCGTACCAAGGC
TACGACAAATCTGCCGACCCCCGAATTTCCAACGTCTTCACCTTTGCCTTCCGCTTTGGCCACTTGGAGGTCCCCTCCACTGTGTCCCGCCTGGATGAGAACTATCAGCCGTGGGGTCCA
GAGGCAGAGCTCCCTCTGCACACCCTCTTCTTCAACACCTGGAGGATAGTCAAAGACG
GTACGTCCTTTTAGGGAAGCACTGTCACCTGGAGGTATCACGCTGCGGTCTGCTTCTAGGGA
AGCCTGGCTTAGAAGTCAGATGCCAGGAACTTCCCAAGTGACATTGGTGAATTCACCTCACTGAGCCTCAGTTTCTTCGTTTGTAAAACAGGGACAACAATGATACCTGTCCCACTAGGA
TATACAAACAATTCAGTGGCATATATGTGGAGAACACCCTACAACAGTTTCTGGCACACAGGAGGTGGTCAATAGATATGAGTTATTGTTCTTTCTCTCCTCTGGCCTTCAAGGTGCCTG
GGCTTTCCCTGCCTCAGGCTTCTCTGACCCCTGCAGAAGGAATTCATTGCTTTGGTAAATAAATTGTTCTTTTCTGCTCTCCGCTTGGGCTTTCCACCTCCATCAAGTGCCAAAGATTGG
GCCCAGCTGCCCTTTATCCTGGGCTGGACTGCATTGAAACTGGCTTTACGTAAGGCCTGACAAGCTAGGGCCATTCTTTATAGCCTTCAGCTACCTCTCCCCATGCCTCAGAGTTCCTCG
GGGGAACATGTAGAAAGAGAAAAAGCCGACTCTCTGAGCCAAAGCTCAAAAAACTCCCAAGCTTATATTCCTGCCACCATCCCAGGAAAGCCCCATTCCCCACCCCCATCCGTACCCCCT
GCAGGCGGTCTAGATGCCCTCAGCCCCAGCACACCCTGCAGGCTGCACCTTGCTCTTCGCTCCCAGCTGCCAGCCTGAGATGCTCAGTTGGCCCTACTTTTACCTGAGAGGAAACATCTG
GCAGAGGGAGGGGTAGCAGTGGAAGACGGCCTCACCCTACCCCGTCCCCAGGATGGCCTCTGGGTCTCCTTTGCAGGTGGAATTGACCCTCTGGTGCGGGGCCTGCTGGCCAAGAAGTCC
AAGCTGCTCAATCAGAATAAAATGATGACAAGAGAGCTGCGCAACAAGCTTTTCCAGCCCACTCACAAGATCCACGGCTTTGACCTGGCCGCCATCAACGTTCAGCGCTGCCGGGACCAC
GGGATGCCTG
GTGAGTGGGCCTGGGGTCCTGCCTGGCCCAGGGAACTTTTCCTTACTTTCTGAGTTTCCTGGGGACTCTCTTTTATAACCCTGGGGATCTGACCAATTCTACAGCGGAAA
GCAGAGATGCCAGTTTTTGAAAATTTATTTAGTTCATCTGTGAAATGGAATCTTCCATTCTCCCTAATGCAGAGATAAGTGAACATATCTAGTACCATCTTGGAGCTCCTCAAATGAACA
AGAGGCCAACAACTGATTGTCAAGCTGGTTTAAAAGCCCAGAAAAACATTAAGAAAGGAAAATAGAGAGAAACCAATGACTTTTGGACCTTTCTTTTGTACCCACGAAAGGCAATTTAAT
GTAATAATTAAGAGCCAGATGGGCTGGGTTCAAATCCCTGCTGTGCCATTTGCAGTGACGTGACCGTAGGCAAGTTACTTAACATCTGTGTTCTTCAGTTTACACATTTATGCAGGGCTT
AGAGTAGTGCCTGGAATAGCAAGGACCATATGACCTGCCAGCCCTCTCAAGCCTAAAGTAGCACAAAGACAAAATAATGGAGCCCTGCCCACCCCGCCCCAGAGGCTATGAGCCCAGACT
TTCTGGGGCTGATGGAGCTGGAGCCGGTATGTCCCCAAGGGGGGCTGTGGGTGAGAAGCCCCTGGGATGAGACAGCTTCAGCCCCTCCGCCCTAGGGTACAACGCCTGGAGAGGCTTCTG
TGACCTCCCGCAGCCCCAGACCCTGAAGGAGCTGAATGCTGTGCTGAAGAACAGAAGGCTGGCTAAGAAGTTACTGGAGCTCTACGGGACCCCTGACAACATCGACATCTGGGTTGGGGG
CGTTGCTGAGCCCCTGGTAGAGAGGGGCCGGGTGGGGTCTCTCCTGGCCTGCCTCCTGGGGAAGCAGTTCCAGCAGATCCGTGATGGAGACAG
GCAAGTGAGATCTTGTGAGCAGGGCTG
GGGAGAGCAGACCCTTCTCTATGGGCGTCCCAAAGTCCTGTGTGAGGACTTGCCCAGACCTCAGTGTGCTCCCAGCCACCTCCTTCCTCCCCCTTGGGCACAGGGGGGCAGGGGGTCCAC
CCCTGGGCTGTGTGGACAGACCCTGCTTCTGTCTCTGCAGATTCTGGTGGGAGAGCCCTGGGGTCTTCACTGAGAAGCAGCGGGACTCTCTACAGAAAATGTCCTTCTCACGCCTCGTCT
GTGACAACACCCACATCACCAAGGTCCCACGGGACCCATTCCAGGCTAACAGCTACCCCCAAGACTTTGTGGATTGCTCAGCCATTGACAAGCTGGACCTTTCACCCTGGGCCTCCGTGG
AGAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACTTGGCAGCAATGCGGGTCCTCCTCCATCTCCCAGCCCTTTTAGCTTCCCTGACCTTGCTCCAGGCTGCAGCGTCGGCAGCAAATGCACCACCCACCACGACTGCTGCCATCTCC
GACGCTGTGAGTCAGGTCAAGGTCCAAGTCAACAAGGCCTTCCTGGAATCCCGGACCAG
GCTGAAGACGGCCATGAGCTCTGAGGAGCCCACCACGCGACAGCTCTCGGAATACTTCAAG
CATGCCCGAGGCCGGGCGCGCACAGCCATCCGCAATGGGCAGGTGTGGGAGGAGTCCTTAAAGAGACTGAGGCAGAAAGTGGCCTTGACCAATGTCACAG
ACCCCAGTCTGGACTTGACT
GCACTGTCTTCGGAGGTGGGTTGCGATGCCCCTGTTGCTGTGGTGAAATGTGACGAGGACAGTCCTTACCGAACCATTACAGGAGACTGTAATAACAG
GAGGAACCCCGCCCTGGGCGCC
GCCAACAGGGCGCTGGCGCGCTGGCTGCCCGCCGAGTACGAGGACCGGCTCTCCCTGCCCTTCGGCTGGACGCCGGGGAGGACGCGGAACGGCTTCCCCGTCCCGCTG
GCCCGCGAGGTA
TCCAACCAGATCCTAGACTACCTGAATGAGGAGGGTGTTCTGGACCAAAACAGGTCCTTGCTCTTCATGCAGTGGGGTCAAATTGTGGACCATGACCTGGACTTTGCCCCCGACACCGAG
CTGGGGAGCAGCGAGTACTCCAAAGCACAGTGTGACAAGTACTGTCTCCAGGGAGACAACTGCTTCCCCATCATG
TTCCCTCCCAATGACCCTAAGTTGAGGACTCAAGGCAAGTGCATG
CCTTTCTTCCGAGCTGGGTTCGTCTGCCCCTCTCCACCTTACCGGTCCCTGGCTCGAGATCAGATCAACGCTCTGACCTCCTTCCTGGATGCCAGCTTCGTATACGGCCCCGAGCCCAGC
CTGGCCAGCCGCCTTCGCAACCTCAGCAGCCCACTGGGCCTCATGGCTGTGAACCAGGAGGTCTATGACCACGGGCTGGCTTACCTGCCCTTTGACATCAAGAAGCCAAGCCCCTGTGAG
TTCATCAACACCACCGCCCTAGTGCCCTGTTTCCTGGCAG
GAGATTCCCGAGCCTCTGAGCAGATCTTGCTGGCCACTTCCCACACCCTCTTTCTCCGAGAGCACAACCGGCTGGCCAGA
GAGCTAAAGAGACTCAACCCTCAGTGGGATGGAGAGAAGCTCTACCAGGAAGCCCGGAAGATCCTGGGAGCCTTCGTGCAG
ATTATCACCTTTAGGGACTACCTACCCATTGTGCTCGGT
GATGACATGCAGAAATGGATCCCTCCGTACCAAGGCTACGACAAATCTGCCGACCCCCGAATTTCCAACGTCTTCACCTTTGCCTTCCGCTTTGGCCACTTGGAGGTCCCCTCCACTGTG
TCCCGCCTGGATGAGAACTATCAGCCGTGGGGTCCAGAGGCAGAGCTCCCTCTGCACACCCTCTTCTTCAACACCTGGAGGATAGTCAAAGACG
GTGGAATTGACCCTCTGGTGCGGGGC
CTGCTGGCCAAGAAGTCCAAGCTGCTCAATCAGAATAAAATGATGACAAGAGAGCTGCGCAACAAGCTTTTCCAGCCCACTCACAAGATCCACGGCTTTGACCTGGCCGCCATCAACGTT
CAGCGCTGCCGGGACCACGGGATGCCTG
GGTACAACGCCTGGAGAGGCTTCTGTGACCTCCCGCAGCCCCAGACCCTGAAGGAGCTGAATGCTGTGCTGAAGAACAGAAGGCTGGCTAAG
AAGTTACTGGAGCTCTACGGGACCCCTGACAACATCGACATCTGGGTTGGGGGCGTTGCTGAGCCCCTGGTAGAGAGGGGCCGGGTGGGGTCTCTCCTGGCCTGCCTCCTGGGGAAGCAG
TTCCAGCAGATCCGTGATGGAGACAG
ATTCTGGTGGGAGAGCCCTGGGGTCTTCACTGAGAAGCAGCGGGACTCTCTACAGAAAATGTCCTTCTCACGCCTCGTCTGTGACAACACCCAC
ATCACCAAGGTCCCACGGGACCCATTCCAGGCTAACAGCTACCCCCAAGACTTTGTGGATTGCTCAGCCATTGACAAGCTGGACCTTTCACCCTGGGCCTCCGTGGAGAATTAG

Retrieve as FASTA