Entry information : SscEPO
Entry ID 7980
Creation 2011-02-03 (Christophe Dunand)
Last sequence changes 2011-02-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-02-03 (Christophe Dunand)
Peroxidase information: SscEPO
Name SscEPO
Class Eosinophil peroxidase    [Orthogroup: EPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Suidae Sus
Organism Sus scrofa (Pig)    [TaxId: 9823 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SscEPO
start..stop
S start..stop
PtroEPO 1280 0 1..715 1..715
GgoEPO 1279 0 1..715 1..715
HsEPO 1278 0 1..715 1..715
EcabEPO 1272 0 1..714 25..738
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..76 76 N° 2 184..277 94 N° 3 527..702 176 N° 4 881..998 118
N° 5 1093..1222 130 N° 6 2617..2823 207 N° 7 3958..4276 319 N° 8 6302..6462 161
N° 9 7288..7543 256 N° 10 7991..8161 171 N° 11 10868..11105 238 N° 12 11672..11873 202
join(1..76,184..277,527..702,881..998,1093..1222,2617..2823,3958..4276,6302..646 2,7288..7543,7991..8161,10868..11105,11672..11873)


exon

Literature and cross-references SscEPO
DNA ref. GenBank:   NC_010454.1 (32350617..32337979)
mRNA ref. GenBank:   XM_003131639.1
Protein sequence: SscEPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   715 (693)
PWM (Da):   %s   80622.43 (78325.2)  
PI (pH):   %s   10.67 (10.76) Peptide Signal:   %s   cut: 23 range:23-715
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLLLALEGALATLILAWSCEGTAPASPRTVETSVLQGCITEAKLLVDAAYNQTERSIKQHLRSGSASPMDLLSYFKQPVAATRTVIRSADYMHVALGLLEEKLQLQGSRSFNVEVLTKPQLWLLSQASGCALQDKVEKCSDKYRTITGRCNNKKKPWLGAANRALARWLPAEYEDGLSLPFGWTPGKKRHGFLLPVRAVSNQIVRFPSEKLTSDWGRSLMFTHWGQFIDHDVTFSPESLARVSFTTGVDCEKTCAQLPPCFPIKIPPNDPRIRNQRDCIPFFRSAPSCPQNKNKIRDQINALTSFLDASMVYGSEVALSLRLRNRTNHLGLLAVNQRFQDNGRTLLPFNNLHEDPCLLTNRSARIPCFLAGDTRVSETPQLTAMHTLFVREHNRLATELRRLNPRWNGDKLYQEARKIVGAMVIITYRDFLPLVLGKARARKTLGPYKGYSSKTDPSVANVFTLAFRFGHTTLLPFMFRLDSQYRASAPNSWVPLSSAFFASWRIVHEGGIDPILRGLMATPAKLNRQDSILVDELRERLFQQVKRIGLDLAALNMQRSRDHGLPGYNAWRRFCGLSQPRNLAQLSRVLKNQALARKFLNLYGTPDNIDIWVGAVAEPLLRGARVGPLLACLFEKQFRRVRNGDRFWWQKYGVFTKRQRKALSHISLSRIVCDNTGITTVPRDIFKAKIYPQGFVPCSRIPSLKLSAWRGT

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 12).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTGCTCCTGGCCCTGGAGGGGGCCCTGGCCACACTCATCCTGGCCTGGTCCTGTGAGGGCACCGCCCCAGGTAAGAGCCCCTTGGACAGCCAAGGAGGAGGGCAATGGAGGGGT
AGCACTTGGGTCTGGGGGAACCTGTGGCTGCCCTGGACTCTGAGTCCCATTCCTTCCAAACAGCTTCGCCCAGGACTGTGGAGACCTCAGTCCTTCAGGGCTGCATAACTGAGGCCAAGT
TGCTGGTAGATGCTGCCTACAATCAGACAGAGAGGAG
GTAGGCCGGGACCTGGGTCTGGGGCCCGCATGGGCCTGGGAGGACTGACGCGGGGGATGGACTCCAGCCAAGATGTGATCTCG
CCCATCACCTGCCCCTGGGCAACTTGGGGCAGGGCCATGTCAGTAGAGAGCCTTCCTTCCGTCCATCCTTCTGTCTGTTTGCACTGTCTTGACTGTCCACAGGTGGGGGGTCTGCTGGGT
GGGTCTGCTTCCTCTCTCCAGCCTTCACTCCCCCTCTTCTGGGCAGCATCAAGCAGCACCTTCGCAGTGGCTCGGCCAGCCCCATGGACCTTCTGTCCTACTTCAAACAACCGGTGGCAG
CCACCAGGACAGTCATTCGGTCTGCTGATTATATGCACGTGGCCTTGGGGCTGCTGGAGGAGAAGTTACAGCTCCAGGGGTCCAGATCCTTCAACGTCACCG
GTACTGTGCTCCCCATTG
GGCCCCCAGGGCCCTGGGAGTGGAAAGAAGCGGGGACGGGGGTTCAGGGTACCCAGCCTCGGGATGTTGGAAGTGGATAGGGGAAAGGGATTGGGGGGGGCGGGTACAGAGCAGACCAGC
TCAAGGAGCTAGACCCCTGCCCCTGCCCACCCCCCTCCAGAGGTGCTAACAAAACCCCAGCTGTGGCTGCTGTCCCAGGCCAGCGGCTGTGCTCTCCAGGACAAAGTCGAGAAGTGCAGT
GACAAGTACCGAACCATCACCGGGAGATGCAACAACAA
GTGAGTACCCGGGGCAGCATCTGACCTGGGGATGCCCTGTCCCCTCCCCTCCTTCCCAACCCTGCTGACCGCAGCCCACCGC
CCCCTGCCACAGGAAGAAACCCTGGCTGGGGGCCGCCAACCGGGCCCTGGCTCGCTGGCTGCCAGCCGAGTATGAGGACGGGCTGTCACTCCCCTTCGGCTGGACCCCCGGCAAGAAGCG
CCACGGCTTCCTCCTCCCCCTG
GTGAGTCAGGGGGCGGGTCTGGAGGATGCTCCATCTCCGCCAAATGCTGGGAGTCAAAGCGCAGCCCAGAGGCAGCCGGACAGGCTCGCATCCAGGAT
CTACCACGGGCTGGCCGGGGACTTGGGACAGATGCTGCAGCTGAGTCTGAGTTCCCTCAGCCATAAAACAGCAGTAAAACCCACGTCCCACTGCTGTTGTGACCATTAAATAGAGTCCTT
GATATAAACATCCATGTGGGATGTTATATGGGAATGCTGGCCATTACAGCGTCGTTTTCTTCTGAAAGAGTGTCAAAGTACCTTGCTAAATGTAAAAAGCAATTATTATCATTATTATTT
TGTCTTTTTGCCATTTCTAGGGCCGCTCCAGCGGCATATGGAGGGTCCCAGGCTAGGGGTCGAATCGGAGCTGTAGCCACTGGCCTATGCCACAGCCACAGCAACGCGAGATCCGAGCCG
CATCTGCGACCTACACCAGAGCTCACGGCAACGCCGGGTCCTTAACCCACTGAGCAAGGCCAGGAATCGAACCCGCAACCTCATGGTTCCCAGTCAGATTCCCTAACCACTGCGCCACGA
CGGGAACTCCAAAGAGCAATTATTGACCTAAACTACTTCACATTTACCAATTTACCAATTGTTTATTCCCATGACAACCTATCATCTACTCATCTGTCAACCTCTCATTATTAATTTTTC
TTCCATTGATCTTTCCATCTAATTCTCTATGTATTTACTATCGCTTCCCTAGCAACCAATCCTTGCATTTATCAATCAGTTCCATCATGTAATTTTCCAGCCTGTAAATCGATCCGTTCA
ATTTGATCTATTTAAACCTCTGGAAAAGCTGGTGGTGTCTGAGGCAGCCAACCCAGCCCCTCCCTCTCTCTTTACCCCTGGAATCTTCAGGAGCGAGGCTAGAGACCATCCCTGTAGGAA
TGACAGCCTCACAGGAGGTGGGACGAAACGGGAAAGGGGAGGGAGTTCCCGTCATGGCTCAGAGGTAACTAACCTGTCTAGTATCCATGAGGATGCAGGTTCAATCCCTGGCCTCGCCCA
GTGGGTTAAGGATCCGGTGTTGCTGGGAGCTGTGGTGTAGGTCAAAGATGCAGCTCAGATCTGGCATTGCTGTGGCTGTGGTGTAGGCCAGCAGCAACAGCTCCGATTCGACCCCTAGCC
TGGGAACCTCCATATGCCACGGGTGCGGCCCTTAAAACAAAAACAAAAACAAAACAAAACAAAACAAAAAAAAACAGGAAAGGGGAGGGCAGGAGAGGAGGAGAGACTGTGTTTGCTCCA
GCTGGGGCAGCTTGTCACACCCCTGAGTGCTGGATTGGCTCTGGCACCTTGCGGGGTCAGGAGCCCACACCCTACGCTGGCCTCTCTCCCCACCAGGTGCGGGCTGTCTCCAACCAGATC
GTGCGCTTCCCCAGCGAGAAGCTGACCTCCGACTGGGGCCGGTCCCTCATGTTCACGCATTGGGGCCAGTTCATCGACCACGACGTGACCTTTTCCCCTGAGTCCCTAGCCAGGGTGTCC
TTCACCACAGGTGTCGACTGTGAGAAGACCTGTGCCCAGCTGCCCCCCTGCTTCCCCATCAAG
GTACCTCCCCTCATCAGGGCCCCCCTGATGTGGCGTCCACCCCTGGCCTAGAGCTGG
AGCTGGGCGTCTGGAAGCCTAGAGCCTCTGCCTTGAAGAAGGTGGTGAAGCCAGAGTAACAGAGAGACGAGAAGCTTTCTGCTTCTGGGTGTGTTTGGAAGGTGGGGGGAAGGGCAACCT
GCCCGGAGGTTCAGTGCGGGCTTCACAGAAGGCAAAGCCGTGGAGACTGGCCTGGACCAGTTCGGGGTCCAGTTCCAACAGGGGAAGCCTCTGGGCTGCTGCTTGTGGAAGCCTTTAGGG
TCTCTCAGCTCTTGCTCTTCGCTCCTTCCTGAGATGGTCCGAGGGCCCTGCGGTTCTCACCAATTTCTGGAATCGCATTGTAAGCACAAGGGGCTCCTTCATGCCGAGACAAGGATGGTG
TGGGATGCTAGGGAAGAAAAGACGGACTCCAGGGAGCAGAGCCTCTGCTGGGGACGGAGGGGACCCTCCGTGCACACACTCAAATATTCCCTCGCCCTTACAGTGTAGGGTGACCTCCTC
AAAGCATGACACATGAGATCTCCTGGCTGGCTCCTTCCTCAAGCTACTCTAGGAGCTTCCCTTATCTTCCTATCACACCTTTAGCTTTTGACTTTTTGACCAAGCACCACAAATGCCACT
TTGATTTAGAGTCACTCCATGTTGGCGTCTCTTTCCACTGAGTTGCCAGCTTCCTGCTGCCTGTCCTGAGGGTCGGTAGCCTTCACTGTCTCCAAAGCACCAAGCACAGAAAGGGGCTTA
GGAGATGTCTGTCAAATCGAATGGAATGAAAGGACCACAGGATTATATGCCAGGGAACTAAGCTCTAATTCCTCCTCTCCCACTATGAAGTTGTCACTTCCCCTCTCTGAGCCTCATGTG
TGGAGGGTCACAGGCCGAAGAGGTCTAAGGACCCACCCATTTCTAACCTTTCAAGACCCTATTACAGAAAGGGCCAAGGAGGCTCAGATGCCCTGGTGAGCAGCGGGAGTCTGGATGAGT
CAAGGAGGGCTTCCTGGAAGAAGGGAGTTTAGAGCAAGCTTCGGAAGCAGGTGGGGGAAGAGGAGTGAGCTTGCTCTTGAGGGGCCCCAGCATCACCGGGCACTTCTTCCACCTCAGATC
CCACCCAACGACCCTCGCATCAGGAACCAGCGTGACTGCATCCCCTTCTTCCGCTCAGCACCATCATGCCCCCAAAACAAGAACAAAATCCGCGACCAGATCAATGCGCTCACCTCTTTC
TTGGACGCCAGCATGGTGTATGGCAGCGAGGTCGCCCTCTCCCTGCGCCTCCGCAACCGGACCAACCACCTGGGGCTGCTGGCCGTCAACCAGCGCTTCCAGGACAACGGCCGGACCCTG
CTGCCCTTCAACAACCTGCACGAAGACCCCTGCCTCCTCACCAACCGCTCCGCGCGCATCCCCTGCTTCCTGGCAG
GTCAGACCCGGGTGGGGTGGATGGGTGGGTAGGACAGCGGAAGG
TGTTGTCACCCCAGCAAACAGCAAGTCCCTGGGTTCTGGGTTGGACAGCCCGGTGGGAGTCGGTTGGGGTGTATGGCTCTGGAGCTCAATGTTAGGCACACAGGTCTATGCATATTCGTC
GCAGAATAAGTACAATGGAAGGATTCCCTTTGCAAACGCTTCAGGTGTGGCCAGACCTGCTTGACTTTCCCCCGCGATGAGGGGCTTGCTGCATATACAGAGCTGCACTCCATCTGGAGT
GGCGCTGACTGTCAGGCCCCTCTCATTTATTTATTTACTTATTTATTTATTTGTTCCTTTGTTTTTTAGGGCTGCACCCGTGGCATATGGAAGTTCCCAGGTTCAGGGTCAAATCAGAGC
TGTAGCCGCAGGCCTATGCTACAGCCATGCGGGATCCGAGCCGCATCATCAATCTACACCACCACTCCCCAAAACACCAGATCCCTGACCCACTGAGCATGGCCAGGGATCGAACCTACA
TCCTCATGGATACTAGTCAGTTTTGTTTCTGCTGAACCACAATGGGAACTCTTTTTTTTTTTTTTTAATGGCCACTCCCACAGCATATGGAAGTTCCCCAGGCCAGGGATTGAGTCAGAG
CCACTCTGGAGCCACTTCCATAGGAGTTGCGACAAATGCCAGATCCTTTAACCCACTGTACCTGGCCAGGGATGGAACCCGTACCTCTGCATGGATCTGAGCCACATGGGAACTCCAAGC
CGCCCCCCCCCCGCCTTTGCTCCAATGTCCATCTGTTGCTCTTCATCATGTTTCTGGAACCTCTGAGAAAAAGCTCTCTCTTTTTCACACAATAATAGCCTCTTTAGTTACCTGAAAGTA
GCTTTTACTTCCACCTGATTTTTTTCTTCTCTGGGCTAAATTCCCTTAGGCGCTTAGTTTTCTCCCATTGTTACTAGATGTTCGCCTGGTACTTTCTTCCAGATGATGCATAATTTACAC
TGTCCCAGGGGTCTCCCCTGCCACCTCCGTGCTGGTTATAATAATGATGGTCATTGTTTCTCATTATTTAAGATATTTAAATGTGCCATCCATAATCCTTCCAGCAGCCCTGAAGGGAAG
GCATTGTTATCACCCTTGTTTTGTTGAAGAGAAACTCGGGGAAGACAATCAATGTGCTCCAGAGCAGAGTGTCAGATGGCAAAGTACCCCCTGGGGACACCAGTCAGGGTAGTGGCCAGG
TCGGAGCTCTTTCCACTTCACTCCACCACCTTCTTGGGAAGTTGGCTCCAGCCCCTTTCCTAAGGATTCCATGGTTCTTTGCTCCCAGCAAGAGCAGTGTCCTTGGCAAGAGGTCTATTT
AAAGAGTACATGGAATAAGATCATGTACCCAAGGGCTTGGTTCAAAGTCAGCCAATGACTACACGTAAGCCACCTTCGGGAACATTCTTTCCCTTCCTGGCCTCTAGGAGAAGGTCCAGC
TATGGGAACAGTCTCTGCTCAACCATCCTTCTGTCTCCTTCCCTGGGGGTCCCTGGGGAGAGCCGCGTGACACCAAGCTGATGAAAGGTCCATGTGCTGGAAGAGGATGTGCTGAGGGGC
AGAGGATGTGCTGAGAGGATGTGCCACCCATAAGACAGGTGGACTTGGTCCTGAAGGCAAGGTTCCTAGAGTCGCCCAGGTCCTTCCACCAGCTGTGGATGTGCTCATCCTGCAGAGCAG
AATCATTAGGCAAAGACTTTCCTGCCCAAGACCAGCAGCTGCCCTGTGCTTTCCCACCTGGTCCAAATCCACTTGGGGAACTTAGGGACTGGAGGGTCCCCTGTCTTGCCCCTTCTGGCC
CATTGTGTTGGTCACAGGAGGCTCACAGCACATCTCCTAAGGAGATGGAGGGCCAGTGAGGGCCAGGAATTTGGCACAGGTCACAAAATCCCAAAATTCTAGTCCCAGAGCTCTGTTGGC
CTTAGCAGAAAGACATTTCTCTGGAAAGTACTCTAGTGACTCTGAACTTGGGGTTTTCAAGGTGATACCCGGGTCTCTGAAACCCCCCAACTGACAGCCATGCACACCCTCTTTGTGCGA
GAGCACAACCGGTTGGCAACTGAACTGAGACGCCTGAATCCCCGGTGGAACGGAGACAAGCTGTACCAGGAGGCTCGGAAGATCGTGGGGGCCATGGTCCAG
GTAGGGGGCCCTGGGTTC
CAGCAGCCCTTAGAAGGCAATTTGTGCCTCGAGTCAGCCAGGTCTGGGTACTTGGGGATGTTCCTGTACCCCCAATTCTGCCCCAAACTCCCTCTGTGCCCTGCCCATGTCACCCAGCCT
CTCTGGAATCCAGTGTCTCCATCAGACAATGGGAAATTAATGTTACCACATTTGACATGAGGCCAGTAAAGAATTAGTATGTCCGAGGAGTCCCTGTTGTGGCTCAGCAGGTAAGAACTC
GGCTAGTATCTACGAGGATGTGGGTTCCATCCTTGGCCTTGCTCACTGGGTTAAGGATCCAGCCACAAGCTGCAGTGTAGGTTATAGATGTGGCTTGGATCCAGCATTGCTGTAGTGTAG
ACAGGCAGCTGCAGCTCCAATTTAACCCCTAGCTTGGGAACTTCAATACGCCATGGGTGTGGCCCTAAACAGCATTTAAAAAAAAAAAAAAAAAAAAAAAAAAGAGGGAGTTCCCATCAT
GGTGCAGCAGAAATGAATCCAACTAGGAACTATGAGGTTATGGGTTCCGTCCCTGGCCTCGTTCAGTGGGTTAAGGATCCAGCGTTGCCATGAGCTGTGGTGAAGGTTGCAGACGTGGCT
CGGATCCTGAATTGCTGTGGCTGTGGTATAGGCCAGGAGCTGTAGTTCTGATTGGACCCCTAGCCTCGGAACCTGCATATGCCTAAAAAGAAAAAAAAAAAAAAAGAATTATGTGTGAGC
AGCCCTTCGAAAAGCGAAGATCTGTTGGAAAGCAAGGGAGTAGGGTGAGCAGCCGCTAAGGTATTGTTTCTCCTTCTTTTCTTCTAGATCATCACCTACCGGGACTTTCTGCCCCTGGTT
CTGGGCAAGGCCAGGGCCAGGAAAACCCTGGGGCCCTACAAGGGGTATTCCTCCAAGACAGACCCCAGTGTGGCCAACGTCTTCACCCTGGCCTTCCGCTTCGGCCACACCACGCTCCTG
CCCTTCATGTTCCGCCTGGACAGCCAGTACCGGGCCTCGGCACCCAACTCGTGGGTCCCTCTCAGCTCTGCCTTCTTCGCCAGCTGGCGAATAGTGCACGAAG
GTGACCAGGTTTTCCAG
AGGCAGATGGGAATGGGAATGGGAGTGGAGCCCCTCTTAGTGGCGGAAGACCAGGCACCTGCTCAGGCCACTGCTAATCACCTCCCTGGGACAGTGAAAACAAGGCAGGTGCCACCAAGA
CCCTCAGTCATGGGCCTCCCATACCCTCTGGGATCAGAAGCTTTCTAAAACGGGAGCAGACTGGTGGCTGCGGTCCTGAAAAGAGCTGGCCTTCCCCTCCTTCTTAAAGAAGTGGGGTGA
TTTCTTTTCCTGCTGGCCCCAGCGCTCTTCCTGTCCCCCCAGGCCAGTGTTTGCTGATACAAACCATATAGATAGAATGTGAGGGGCTGGCTTGTCCAGCTCTGCCCTGCCCAGGCTGGC
ATCTGGTACTGACCCAAGGGGCTTCCATGAGGCTGGTCCAACCCGTGCTGTTCCTCTTCCCCACCGCCAGGTGGCATCGACCCCATCCTCCGAGGCCTCATGGCCACCCCTGCCAAGCTG
AACCGTCAAGATTCCATATTAGTGGATGAGCTGCGGGAACGGCTGTTTCAGCAAGTGAAAAGGATCGGACTGGATCTGGCGGCTCTCAACATGCAACGCAGCCGGGACCATGGCCTCCCA
G
GTGAGGGGGCCGCCCGACCCTCCTCCCAGGCTCCACCCAGTGAGGGCTGCTGGTGGGAGGGGGTGTTTCTGAGAGAGCCCTCAGCGCCTCTTTTCTGATTGGGACCGTACGGGATGGGC
TGTGTGGTTCAGAGGCACACAAGGCTGCGGCTGATGCGACAGAGCATCCCGCACACTCGTTTTTGTTGTCCTGCCATGTCTTGATTCACCATAGGGTCTCTAGCATTAGGGTCACAACAG
GATCAGGACTGCGACACACGGGCTGAACAAAGGAAATCAGGACTTTCCAAGTAGAGAAAACTAGTAGCTTTAAAAGGCAGGGAAGAGCTGTTCCATTTCCCACCAGCCTGGCAACAGCCA
GGGATGGGAGCTCCTGTTGTGGCTCAGCAGTAACGAACCCGACTCGTATCCATGAGGACGCAGGTTCAATCTCTGGCCTTGCTCAGTGGGTTAAGGATACCGTGTTGCTGTGCGCTGTGG
TGTAGGTTGCAGACATGGCTCGAATCCCCAGTTGCTGTGGCTGCAGCTACAGCTCTGATTCGACTCCTAGCTTGGGAACTTTCATATGGAGCGAGTGCAGCCCTAAAAAATGAAAAAGAT
AAGATCCAGGGATGAAGTTCCAAGGATATAGAAACTGGCTCCTGTCTCTAACTAAGTGGGGAAAAGTGAAGAGCCTAAAAGAGGCAGGGAACAGGTGGAATAAAAGACAGCTTTGGTTGT
TTGGTGAGGACAAAAAAAGACTTTATCCCAGGAAAGAAGAAAAATGAGGCACTTTGCCAGGAACTTTAATGGATATTAACTCTTTCAGTCCACCCAAGGACCTTGAGAAGCAGCCGTGAC
AGCCATTTCTAGAGATGAGGAAAGAAACTCAGAGACGCCTAGTAATTGGCCCAAGCCCACATAACAAGGAAGTAGTAAAATTCGAATCAAGATCAAAATTTCTGGAGTTCCCGTCGTGGC
GCAGTGGTTAACGAATCCGACTAGGAACCATGAGGTCGCGGGTTCGGTCCCTGCCCTTGCTCAGTGGGTTAACGATCCGGCGTTGCCGTGAGCTGTGGTGTAGGTTGCAGACGCGGCTCG
GATCCCGCGTTGCTGTGGCTCTGGCGTGGGCCGGTGGCTACAGCTCCGATTCAACCCCTAGCGTGGGAACCTCCATATGCCGCGGGAGCGGCCCAAGAAATAGCAACAACAACAACAACA
ACAACAACAACAACAAAAAAAAAAAAAAGATCAAAATTTCTCCTTTTCATCCCTTGTTTAATCCGTGTTGTTAGGGGAAGACTTTGGCTACATTCTTGTTCATCTCTCACTTTCGCCTTC
TCCTACATCTCTGTCCAAATACACCCTAAAGCCTCATCTGCGTCTGCAAATCTTCAGCTGTGGGTAAGGAAGGGCAGGCAGTTCGTACTGCACCTAACACAGCACCTGGGAGACACAGCA
GGCACTCGAGAGCCTGAGTTTCTCCCTGGGGTTTCTAATGGTTAGAAGTCTGTGTTCTCGAGAACCTGAGTTTCTTTTCCTTCCCTGGGCTTGGGTGCTCCTAACAGCTAAAGGGTTGTG
GGCGCCCCCTGCTGGAGATCTGAGATTGCTGGCCACCCCAGTTGTGGCACAGAGAGTTTCTGTTCGCTTCCAGCTGTCCCAGAAATCTTTTCTTCATCCTAGCTCTTTCAGTCTCCTCCA
ATCCCTTCCTAAGTCCAACTCCAAATTGGGAATTGGAAGGTCTGGTTTGAACTCCACTCAATAGTGGGATGAACTTGGAAAAGTCACAGTTGCTCAAGCTCAGCAAATATCCATTGATAA
CATGGGGATTCTTACAAAGTACCTCAAAAAAGTGAGAGGATCCTGAGAGAGTCACACAGCAGGGCTTAGCAATGGTGAAACGATATACGGTTTTCCTTTTCAGCTGAGGGATGGCGTTTG
GGAGCAGTAGTTCAATGGAGAACGTGGGGCCGAGGTGTCTTTGGGTCACGGCAAAGCTCTCGATCTCCTATCTTGATGGTTCCCACCATAGCATGTGACTTGACCCTGTGACCCTGATAG
CTGAGAAATCATTATGGCTGGTCTTTGCAAGTGAAAAAAAAATTTTAACAGCTTTATTGAGATATAATGAACATATCATCAAATTCACCCATGTACAAGTATATACTTCAATGATTTTTA
TTATAGAGTTGTGCATCACATCTCACATCAGCATTTTCATCCCTCACAGAAGAAACCTGGCAATGACAGCCACTCCCCATCCCTCCCTCAGCCCCTGATAATTACTAATCTTTGTGCCTA
CATATTTGCCTGTTCTGAACCTTTCATATCAATGGAACCATCGACTTCTCAGCCTTGCTGTTCCGAGTAGATAAATTTTATCCATGCTCTTCATTTCTTGGTTTGTTCACTCATTCATTC
ATTCAACAAATCCCAGAGGCTTTCATGTTTTGGGTACTGTCTTATTGGTGCCTGCTTAAGACCACAACAATGTCACTGTGGTTGTGAGTGTTGGGTTACAACAGCTTCTTCCATTAGAAC
ACACTCCTCGGTTGCATGCACAGTGGTTTAGCCTTTGGAAGGTTCGAGGCCTTTTCTGCCAGCGAGGGCTGTCTTCTGCCCAATATTGCCTGACCACAGAACTCTCTCAGGAGACATTGT
GGAGAGCAGAAGCTAATAGGAACCCACACAGGTAAGACTAAACTGCTTCTGTCCCCTCTCCCTACAGGGTACAATGCTTGGAGGCGCTTCTGTGGGCTCTCCCAGCCCCGGAATTTGGCC
CAGCTTAGCCGGGTGCTGAAAAACCAGGCTTTGGCGAGGAAGTTCCTGAATCTGTATGGGACACCTGACAACATTGACATCTGGGTGGGGGCCGTTGCAGAGCCTCTGTTGCGGGGGGCC
CGAGTGGGGCCTCTTCTGGCCTGTCTTTTTGAGAAGCAGTTTCGAAGAGTCCGAAATGGAGACAG
GTACGTGACCCTCCCCCTGAGGAACCAGCCCCAGAGGCAGCGCAGAGAAACACTA
GAATTTCAAGCCTCAGCAATGAGAAAAAGCACTCTGTTTGGCTTCATCGGTTTCACGTTCAGAGGAGCTGAGACCAGGAAGCTCCTCCCTGGGGAGCTTGGTCAGAGGGAGCGAGGCCAC
TCCCCTGAGCTGGAGGCACCTTTAATTTAGGAGACCGACTTCTCAGCCTTGCTGTTCCAGGCTTGAGGATCCCAGAAAACATGGGCCAAAAAGACTAAATCTGGTGTCCCTCCAATAAAC
TTGTAGCTTAAGACCTGACTCCTTATTTGGATTTGGCACTTACCTGGGTTCAGATCCAGTCCTGGTTACTTAAATGATGGTGCATTGAACACCAAGCAGTGAATTTGACTGCTGAACCCG
TTTCTTCCTTTATAAAACGGGGTCATACTGACTTTGCGGAGATTTTGGAGAACTGAAATAATGCACGTCAAGTCCCTGGCACACAGCAGCTGCTCATGCCTGTTCATCCCCTGGCCCCCA
ACCTTCACCCATGCGTCCACTGTCTTGCTAGGTTCTGGTGGCAGAAATATGGCGTTTTCACCAAGAGACAGCGCAAAGCCCTGAGCCACATTTCCTTGTCTCGAATTGTGTGTGACAATA
CTGGGATCACCACCGTTCCGAGGGACATCTTCAAGGCCAAAATCTATCCCCAGGGCTTTGTGCCCTGTAGCCGCATCCCCAGTCTGAAACTGTCGGCCTGGAGAGGCACATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTGCTCCTGGCCCTGGAGGGGGCCCTGGCCACACTCATCCTGGCCTGGTCCTGTGAGGGCACCGCCCCAGCTTCGCCCAGGACTGTGGAGACCTCAGTCCTTCAGGGCTGCATA
ACTGAGGCCAAGTTGCTGGTAGATGCTGCCTACAATCAGACAGAGAGGAG
CATCAAGCAGCACCTTCGCAGTGGCTCGGCCAGCCCCATGGACCTTCTGTCCTACTTCAAACAACCGGTG
GCAGCCACCAGGACAGTCATTCGGTCTGCTGATTATATGCACGTGGCCTTGGGGCTGCTGGAGGAGAAGTTACAGCTCCAGGGGTCCAGATCCTTCAACGTCACCG
AGGTGCTAACAAAA
CCCCAGCTGTGGCTGCTGTCCCAGGCCAGCGGCTGTGCTCTCCAGGACAAAGTCGAGAAGTGCAGTGACAAGTACCGAACCATCACCGGGAGATGCAACAACAA
GAAGAAACCCTGGCTG
GGGGCCGCCAACCGGGCCCTGGCTCGCTGGCTGCCAGCCGAGTATGAGGACGGGCTGTCACTCCCCTTCGGCTGGACCCCCGGCAAGAAGCGCCACGGCTTCCTCCTCCCCCTG
GTGCGG
GCTGTCTCCAACCAGATCGTGCGCTTCCCCAGCGAGAAGCTGACCTCCGACTGGGGCCGGTCCCTCATGTTCACGCATTGGGGCCAGTTCATCGACCACGACGTGACCTTTTCCCCTGAG
TCCCTAGCCAGGGTGTCCTTCACCACAGGTGTCGACTGTGAGAAGACCTGTGCCCAGCTGCCCCCCTGCTTCCCCATCAAG
ATCCCACCCAACGACCCTCGCATCAGGAACCAGCGTGAC
TGCATCCCCTTCTTCCGCTCAGCACCATCATGCCCCCAAAACAAGAACAAAATCCGCGACCAGATCAATGCGCTCACCTCTTTCTTGGACGCCAGCATGGTGTATGGCAGCGAGGTCGCC
CTCTCCCTGCGCCTCCGCAACCGGACCAACCACCTGGGGCTGCTGGCCGTCAACCAGCGCTTCCAGGACAACGGCCGGACCCTGCTGCCCTTCAACAACCTGCACGAAGACCCCTGCCTC
CTCACCAACCGCTCCGCGCGCATCCCCTGCTTCCTGGCAG
GTGATACCCGGGTCTCTGAAACCCCCCAACTGACAGCCATGCACACCCTCTTTGTGCGAGAGCACAACCGGTTGGCAACT
GAACTGAGACGCCTGAATCCCCGGTGGAACGGAGACAAGCTGTACCAGGAGGCTCGGAAGATCGTGGGGGCCATGGTCCAG
ATCATCACCTACCGGGACTTTCTGCCCCTGGTTCTGGGC
AAGGCCAGGGCCAGGAAAACCCTGGGGCCCTACAAGGGGTATTCCTCCAAGACAGACCCCAGTGTGGCCAACGTCTTCACCCTGGCCTTCCGCTTCGGCCACACCACGCTCCTGCCCTTC
ATGTTCCGCCTGGACAGCCAGTACCGGGCCTCGGCACCCAACTCGTGGGTCCCTCTCAGCTCTGCCTTCTTCGCCAGCTGGCGAATAGTGCACGAAG
GTGGCATCGACCCCATCCTCCGA
GGCCTCATGGCCACCCCTGCCAAGCTGAACCGTCAAGATTCCATATTAGTGGATGAGCTGCGGGAACGGCTGTTTCAGCAAGTGAAAAGGATCGGACTGGATCTGGCGGCTCTCAACATG
CAACGCAGCCGGGACCATGGCCTCCCAG
GGTACAATGCTTGGAGGCGCTTCTGTGGGCTCTCCCAGCCCCGGAATTTGGCCCAGCTTAGCCGGGTGCTGAAAAACCAGGCTTTGGCGAGG
AAGTTCCTGAATCTGTATGGGACACCTGACAACATTGACATCTGGGTGGGGGCCGTTGCAGAGCCTCTGTTGCGGGGGGCCCGAGTGGGGCCTCTTCTGGCCTGTCTTTTTGAGAAGCAG
TTTCGAAGAGTCCGAAATGGAGACAG
GTTCTGGTGGCAGAAATATGGCGTTTTCACCAAGAGACAGCGCAAAGCCCTGAGCCACATTTCCTTGTCTCGAATTGTGTGTGACAATACTGGG
ATCACCACCGTTCCGAGGGACATCTTCAAGGCCAAAATCTATCCCCAGGGCTTTGTGCCCTGTAGCCGCATCCCCAGTCTGAAACTGTCGGCCTGGAGAGGCACATGA

Retrieve as FASTA