Entry information : BdiPrx44 (bradi1g63067)
Entry ID 7990
Creation 2011-02-08 (Toky Ramarohetra)
Last sequence changes 2011-02-08 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx44 (bradi1g63067)
Name (synonym) BdiPrx44 (bradi1g63067)
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx44
start..stop
S start..stop
BdiPrx43 613 0 2..327 1..324
SofPrx11 521 0 11..325 1..317
SiPrx165 510 0 16..325 1..311
OsPrx40 503 0 23..327 15..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 62275051..62275275 225 N° 2 62274746..62274940 195 N° 3 62274082..62274645 564  
complement(join(62274082..62274645,62274746..62274940,62275051..62275275))


exon

Literature and cross-references BdiPrx44 (bradi1g63067)
DNA ref. Phytozome 12:   Bd1 (62275275..62274082)
Protein sequence: BdiPrx44 (bradi1g63067)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   33989.02 (31304.7) Transmb domain:   %s   i7-24o
PI (pH):   %s   6.34 (6.02) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMASRGYCFVACVVALALALLATASNGQPLDACFYDKVCPAALPAIKTVVEQAVAVEPRMGASLLRLHFHDCFVNGCDGSILLDDTPSFTGEKNAAPNANSVRGFDVIDRIKDAVDAACRGNVVSCADILAAAARDSIVALGGPSYAVPLGRRDSRTASQAAANNSIPAPTLDLGGLVSNFASHGLSVQDLVVLSGGHTLGFSRCTNFRDRLYNETATLDASLAASLRAVCPRPAGDGDDNLAPLDPTPARFDGAYYGSLLRSKALLHSDQQLLAAGATEGLVRFYGANPEAFRRDFAEAMVRMSSLAPLTGSSGEIRANCRKVNGY*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Prediction from ensembl. No prediction from Phytozome. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGCTTCTCGCGGGTACTGCTTTGTGGCGTGCGTCGTGGCGCTGGCGCTGGCTTTGTTGGCCACGGCGAGCAATGGCCAGCCGCTGGACGCTTGTTTCTATGACAAGGTGTGCCCA
GCGGCGCTCCCGGCCATTAAGACGGTCGTGGAGCAGGCCGTCGCGGTGGAGCCGCGCATGGGCGCCTCGCTCCTGCGTCTGCACTTCCACGACTGCTTCGTCAAC
GTACGTACACTACAC
ACTTCGAACTTCGATCTTTCTTTGGATTGGTACGCCGCGCGTACGTATTGCTAATTTGCCACATGTACGTGTACTCGATTCATTTATATATTCAGGGGTGTGACGGGTCCATCCTGCTGG
ACGACACGCCCTCCTTCACCGGCGAGAAGAACGCCGCGCCTAACGCCAACTCCGTGCGCGGCTTCGACGTGATCGACCGCATCAAGGACGCCGTCGACGCCGCGTGCAGGGGAAACGTGG
TGTCCTGCGCCGACATCCTGGCCGCCGCAGCACGTGACTCCATCGTCGCG
GTTCGCCTCGCTCGAATAATACTCTTATATATTGTCACGTTTATACGTACATGCGCGTAACGAATATGAT
CGACCTGACAGTTGAAGTTGTTAATTGCAGCTGGGAGGGCCGTCATACGCGGTGCCGCTGGGCCGGAGGGACAGCCGGACGGCGAGCCAGGCAGCTGCGAACAACAGCATCCCGGCGCCG
ACCTTGGACCTGGGAGGGCTCGTCTCAAACTTCGCCTCGCACGGGCTCTCCGTGCAGGACCTCGTGGTGCTCTCGGGGGGACACACGCTGGGCTTCTCCCGGTGCACAAACTTCCGGGAC
CGCCTCTACAACGAGACGGCCACACTGGACGCCTCCCTGGCCGCGTCGCTCAGGGCGGTCTGCCCGCGGCCGGCCGGGGACGGAGACGACAACCTCGCGCCGCTCGACCCGACGCCCGCG
CGGTTCGACGGCGCGTACTACGGCTCGTTGCTGCGCAGCAAGGCACTGCTGCACTCGGACCAGCAGTTGTTAGCCGCCGGTGCCACGGAGGGGCTCGTGAGGTTCTACGGCGCTAACCCC
GAGGCGTTCAGGAGGGACTTCGCCGAGGCCATGGTCAGGATGAGCAGCCTCGCCCCGCTCACCGGGAGCAGCGGCGAGATCCGCGCCAACTGCAGGAAAGTGAACGGCTACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGCTTCTCGCGGGTACTGCTTTGTGGCGTGCGTCGTGGCGCTGGCGCTGGCTTTGTTGGCCACGGCGAGCAATGGCCAGCCGCTGGACGCTTGTTTCTATGACAAGGTGTGCCCA
GCGGCGCTCCCGGCCATTAAGACGGTCGTGGAGCAGGCCGTCGCGGTGGAGCCGCGCATGGGCGCCTCGCTCCTGCGTCTGCACTTCCACGACTGCTTCGTCAAC
GGGTGTGACGGGTCC
ATCCTGCTGGACGACACGCCCTCCTTCACCGGCGAGAAGAACGCCGCGCCTAACGCCAACTCCGTGCGCGGCTTCGACGTGATCGACCGCATCAAGGACGCCGTCGACGCCGCGTGCAGG
GGAAACGTGGTGTCCTGCGCCGACATCCTGGCCGCCGCAGCACGTGACTCCATCGTCGCG
CTGGGAGGGCCGTCATACGCGGTGCCGCTGGGCCGGAGGGACAGCCGGACGGCGAGCCAG
GCAGCTGCGAACAACAGCATCCCGGCGCCGACCTTGGACCTGGGAGGGCTCGTCTCAAACTTCGCCTCGCACGGGCTCTCCGTGCAGGACCTCGTGGTGCTCTCGGGGGGACACACGCTG
GGCTTCTCCCGGTGCACAAACTTCCGGGACCGCCTCTACAACGAGACGGCCACACTGGACGCCTCCCTGGCCGCGTCGCTCAGGGCGGTCTGCCCGCGGCCGGCCGGGGACGGAGACGAC
AACCTCGCGCCGCTCGACCCGACGCCCGCGCGGTTCGACGGCGCGTACTACGGCTCGTTGCTGCGCAGCAAGGCACTGCTGCACTCGGACCAGCAGTTGTTAGCCGCCGGTGCCACGGAG
GGGCTCGTGAGGTTCTACGGCGCTAACCCCGAGGCGTTCAGGAGGGACTTCGCCGAGGCCATGGTCAGGATGAGCAGCCTCGCCCCGCTCACCGGGAGCAGCGGCGAGATCCGCGCCAAC
TGCAGGAAAGTGAACGGCTACTAG

Retrieve as FASTA