Entry information : BdiPrx87 (Bradi2g38685)
Entry ID 7993
Creation 2011-02-08 (Toky Ramarohetra)
Last sequence changes 2014-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-03-28 (Christophe Dunand)
Peroxidase information: BdiPrx87 (Bradi2g38685)
Name (synonym) BdiPrx87 (Bradi2g38685)
Class Class III peroxidase    [Orthogroup: Prx100]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx87
start..stop
S start..stop
BdiPrx86 439 2e-156 29..324 25..319
BdiPrx85 420 8e-149 30..324 27..323
BdiPrx89 362 6e-126 1..322 1..326
BdiPrx83 283 4e-94 1..327 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38955326..38955536 211 N° 2 38956253..38957025 773  
join(38955326..38955536,38956253..38957025)


exon

Literature and cross-references BdiPrx87 (Bradi2g38685)
DNA ref. Phytozome 12:   Bd2 (38955326..38957024)
EST ref. GenBank:   HX809757.1 [5' end]   HX848832.1 [3' end]
Protein sequence: BdiPrx87 (Bradi2g38685)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (303)
PWM (Da):   %s   34913.69 (32347.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.9 (7.50) Peptide Signal:   %s   cut: 35 range:25-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKRNENVSLSVLLASAVVAILLAAQVNVKPAMAGDYTIGMQTKVRDIVQRNRAVAPGLIRLAFHDCWVKGCDGSVLLERADKQAEMDAPQNGGIRGLDLIQAIKDTLSLDDSTVTCADAVVYAAREACNVLSRRHIVYAVDGPGSHKDTNASSMADAGALPGPTASFANLAANFNGKGFTPRDVVVLSGAHAVGLAHRPNFEARLTANANEISQKYRNDVNVISNASPNKTAHNNVRDLDKAETEPGVLDNNYYAANLGKKVLFSSDFALTTDGAALNNMTNFKNDATMWFRLFEDAMARLSRLPAQGADVLQVPRIKCNAPNPAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1) and 2 ESTs. Incorrect prediction in Phytozome (missing sequence due to extra intron). Missing cystein residues.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGAAGCGCAACGAGAATGTGTCTCTTTCGGTGCTCCTGGCCTCGGCTGTCGTGGCGATCCTCCTTGCCGCGCAGGTGAACGTGAAGCCGGCGATGGCCGGCGACTACACCATTGGC
ATGCAGACTAAGGTGAGGGACATAGTGCAGAGGAACCGCGCCGTCGCCCCCGGCCTCATCCGGCTAGCCTTCCACGACTGCTGGGTCAAGG
TAATTAACTAACTATTGGCAGCAGCTAAT
TTGTTCGTTCATATTTTTTTCAAAAAAGAGGTTGAGATGGATCGGTGTGTTGCTTGGAAAGAGCTAATGTTGAAACCTCCGGTGTCTGCATCAAAATGATGCACACAGCCACGATTAGCT
CATTCATTGCACTGGCATCTCTTCTCAAAACTCAAAACTGAGAAATTAGTTAGTTAGGAAAATAAATAAGAGAAAAGTACTTTTTTCGTTTCTCAACTTGTCGGAAAGTTCGCTTTTCGT
CCCTAAAAAAAATTCGTACTTTTTTCGTCCCTCAATTTTCAAAACCGGACACTTTTAGTCTCTCAGTCCATCCAAAGTGCTTTTCCTAACCACGTGTCTGGTTTTCGTATAGTTTTTTCA
CTTATTTTTTTTCAATCAAGATATGGATGATGCAGATGGAGGAGAAGTATAACTAATGCCTGGACGAGATCCAGAGCACAACGACGGCAATTTCAACAGACTCGGCGGTCACGGGATTAA
GTGCAAACTAGACACGTGGCTAGACAAACCGCTTCGGATAGCCTTAAGGACTGATAGTATCCGGTTTTGAAAGTTGAGGATGAAAAAAGTACGAATTGTTTTTTGAAGGGCGAGAAATGA
ACTTTCCGACAAGTTGAGGGACGAAAAAAGTACTTTTCTCAACAAATAATGGCGATTTGATCCTTCATTCATTGTGACACCTGCAGGGTTGTGATGGGTCCGTGTTGCTGGAGAGAGCCG
ACAAGCAGGCAGAGATGGACGCGCCGCAGAACGGCGGCATCCGTGGCCTGGACTTGATCCAGGCCATCAAGGACACACTGTCCCTTGACGACAGCACCGTCACCTGCGCCGACGCCGTCG
TCTACGCGGCGCGAGAAGCCTGCAACGTGCTCAGCCGGCGGCACATCGTCTACGCCGTCGACGGGCCTGGCTCCCACAAGGACACCAACGCGTCCTCCATGGCCGACGCCGGTGCCCTCC
CTGGACCAACCGCCAGCTTCGCGAACCTCGCGGCCAACTTCAACGGCAAGGGCTTCACCCCACGGGACGTCGTGGTCCTCTCCGGCGCGCACGCCGTCGGCTTAGCCCACCGCCCCAACT
TCGAGGCCCGGCTCACGGCCAATGCCAATGAGATCAGCCAGAAGTACCGGAACGACGTCAACGTGATATCGAACGCCAGCCCCAACAAGACGGCGCACAACAACGTCCGGGACCTGGACA
AGGCGGAGACGGAGCCGGGCGTCCTGGACAACAACTACTACGCCGCCAACCTCGGCAAGAAGGTGCTATTCAGCTCCGACTTCGCGCTCACCACCGACGGCGCCGCGCTCAACAACATGA
CGAACTTCAAGAACGACGCCACCATGTGGTTCCGTCTCTTCGAGGACGCCATGGCCAGGCTCAGCAGGCTCCCCGCGCAGGGCGCCGATGTTCTCCAGGTGCCAAGGATCAAATGCAACG
CCCCCAATCCGGCAAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGAAGCGCAACGAGAATGTGTCTCTTTCGGTGCTCCTGGCCTCGGCTGTCGTGGCGATCCTCCTTGCCGCGCAGGTGAACGTGAAGCCGGCGATGGCCGGCGACTACACCATTGGC
ATGCAGACTAAGGTGAGGGACATAGTGCAGAGGAACCGCGCCGTCGCCCCCGGCCTCATCCGGCTAGCCTTCCACGACTGCTGGGTCAAGG
GTTGTGATGGGTCCGTGTTGCTGGAGAGA
GCCGACAAGCAGGCAGAGATGGACGCGCCGCAGAACGGCGGCATCCGTGGCCTGGACTTGATCCAGGCCATCAAGGACACACTGTCCCTTGACGACAGCACCGTCACCTGCGCCGACGCC
GTCGTCTACGCGGCGCGAGAAGCCTGCAACGTGCTCAGCCGGCGGCACATCGTCTACGCCGTCGACGGGCCTGGCTCCCACAAGGACACCAACGCGTCCTCCATGGCCGACGCCGGTGCC
CTCCCTGGACCAACCGCCAGCTTCGCGAACCTCGCGGCCAACTTCAACGGCAAGGGCTTCACCCCACGGGACGTCGTGGTCCTCTCCGGCGCGCACGCCGTCGGCTTAGCCCACCGCCCC
AACTTCGAGGCCCGGCTCACGGCCAATGCCAATGAGATCAGCCAGAAGTACCGGAACGACGTCAACGTGATATCGAACGCCAGCCCCAACAAGACGGCGCACAACAACGTCCGGGACCTG
GACAAGGCGGAGACGGAGCCGGGCGTCCTGGACAACAACTACTACGCCGCCAACCTCGGCAAGAAGGTGCTATTCAGCTCCGACTTCGCGCTCACCACCGACGGCGCCGCGCTCAACAAC
ATGACGAACTTCAAGAACGACGCCACCATGTGGTTCCGTCTCTTCGAGGACGCCATGGCCAGGCTCAGCAGGCTCCCCGCGCAGGGCGCCGATGTTCTCCAGGTGCCAAGGATCAAATGC
AACGCCCCCAATCCGGCAAGCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GATCCACAGC CGATCGAGAA GCAGTTGAGT TCGCTAGCTG CAAGAACTAA TCTAGGTAGC TCTAGCTAGC AGCTGGTTGG AGGAGCTGAA TTAGGAGATA TATCTCTCGA TTCGATCATG  TCGAAGCGCA ACGAGAATGT GTCTCTTTCG GTGCTCCTGG CCTCGGCTGT CGTGGCGATC CTCCTTGCCG CGCAGGTGAA CGTGAAGCCG GCGATGGCCG GCGACTACAC CATTGGCATG  CAGACTAAGG TGAGGGACAT AGTGCAGAGG AACCGCGCCG TCGCCCCCGG CCTCATCCGG CTAGCCTTCC ACGACTGCTG GGTCAAGGGT TGTGATGGGT CCGTGTTGCT GGAGAGAGCC  GACAAGCAGG CAGAGATGGA CGCGCCGCAG AACGGCGGCA TCCGTGGCCT GGACTTGATC CAGGCCATCA AGGACACACT GTCCCTTGAC GACAGCACCG TCACCTGCGC CGACGCCGTC  GTCTACGCGG CGCGAGAAGC CTGCAACGTG CTCAGCCGGC GGCACATCGT CTACGCCGTC GACGGGCCTG GCTCCCACAA GGACACCAAC GCGTCCTCCA TGGCCGACGC CGGTGCCCTC  CCTGGACCAA CCGCCAGCTT CGCGAACCTC GCGGCCAACT TCAACGGCAA GGGCTTCACC CCACGGGACG TCGTGGTCCT CTCCGGCGCG CACGCCGTCG GCTTAGCCCA CCGCCCCAAC  TTCGAGGCCC GGCTCACGGC CAATGCCAAT GAGATCAGCC AGAAGTACCG GAACGACGTC AACGTGATAT CGAACGCCAG CCCCAACAAG ACGGCGCACA ACAACGTCCG GGACCTGGAC  AAGGCGGAGA CGGAGCCGGG CGTCCTGGAC AACAACTACT ACGCCGCCAA CCTCGGCAAG AAGGTGCTAT TCAGCTCCGA CTTCGCGCTC ACCACCGACG GCGCCGCGCT CAACAACATG  ACGAACTTCA AGAACGACGC CACCATGTGG TTCCGTCTCT TCGAGGACGC CATGGCCAGG CTCAGCAGGC TCCCCGCGCA GGGCGCCGAT GTTCTCCAGG TGCCAAGGAT CAAATGCAAC  GCCCCCAATC CGGCAAGCTA GGACGATCCG GAGGAAGAGA TCGACGTCCT CGCCGGCCCG CGTGGGCCAA GATTTGAGCA GCATATGACA TGCACGCGTT TATAAATTTT TGTTTGGTAA 
TTTTTATATC ATGTTTTTTT TTGTCTACCA ATTGATTTAC TTATGCCAGT ATGTATGTAT TGTAATTTGG TTATTTTTGG AAGAGAAAAG TATAATGTTT TGTCC 

Retrieve as FASTA