Entry information : BdiPrx65 (BRADI2G12204)
Entry ID 7995
Creation 2011-02-08 (Toky Ramarohetra)
Last sequence changes 2011-02-08 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx65 (BRADI2G12204)
Name (synonym) BdiPrx65 (BRADI2G12204)
Class Class III peroxidase    [Orthogroup: Prx071]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx65
start..stop
S start..stop
BdiPrx66 606 0 1..356 1..355
HvPrx12 549 0 1..330 1..328
TmPrx08 548 0 1..354 1..354
TaPrx46 547 0 1..354 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10565453..10565680 228 N° 2 10566954..10567796 843  
join(10565453..10565680,10566954..10567796)


exon

Literature and cross-references BdiPrx65 (BRADI2G12204)
DNA ref. Phytozome 12:   Bd2 (10565453..10567796)
EST ref. GenBank:   DV480154.1 [Fragment]
Protein sequence: BdiPrx65 (BRADI2G12204)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (327)
PWM (Da):   %s   37730.16 (34924.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.85 (6.76) Peptide Signal:   %s   cut: 30 range:30-356
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSNSSLASLAVLLTAVLCLLLPAASHAQLRVGFYNTTCPNAEALVRRAVTAAFANNSGIAAGLIRLHFHDCFVNGCDASVLLSINPGGGTTERDSAPNNPSLRGFNVIDAAKALVEQSCPRTVSCADILAFAARDSVNLTGTNSFYQVPSGRRDGIVSRATDALNNLPGPNSTADDLIKGFAAKTLNAEEMVVLSGSHTLGRSHCASFLFKNRERLASGTISPAFQALLEALCPRNTGQFTPVTTEIDLSTPVVLDNNYYRLLPLNLGLHFSDDQLIRNGTLNVFVNQFIANQTLWKQKFFAAMIKMGNIEPKTGTQGQVRLNCSIVNAASSSSSAVVIEMPLVPEDHDEVATS*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST. Prediction from ensembl. No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGCAGCAACAGCAGCCTGGCCAGTCTGGCGGTGCTGCTCACGGCCGTGCTGTGCCTGCTGCTGCCGGCGGCGAGCCACGCGCAGCTGCGTGTGGGGTTCTACAACACCACCTGC
CCCAACGCCGAGGCGCTCGTCAGGCGGGCCGTCACGGCGGCCTTCGCCAACAATTCCGGCATCGCCGCCGGGCTCATCCGCCTCCACTTCCATGACTGCTTCGTCAAT
GTAAGCGAGTTT
ATCCGTAGGGATGCGCGGGGAAATGCACTTTTCGTCACCAATCAACATCCGTATGGTTACTAAAAGTTTCCGAGGCATAGCTTTTTTTCCAGCTTCCAAGCACGTGTGGTCAAGTCCTTT
TATGCACGAGTAGTTTCGTCAAGTGCTTTTACAAAAAAAAAAAAGTTTCGTCAAGAGATTATGGCTAACTTAAACTAACAAAGCTGAATCCTAACATGCAAAAGAGTCTAATAATATGGA
TCTTCAGGCTTCAGCATCCTTTTTTTTTTGCGCAAACAGGCTTCAGCATCGATGTGAAAAAAAAAACGATATCCATATTAATTGTTTCAAATTTGTCCAAATATGGATGTATCTATCCTA
AAAATTAAGCGTCTAGTCTAAATGCATGTAATATTTTGACTATTAAAATGGATCGGATGGGTATTATCTTTGCTCAAGGAAAATAAATGCATGGCACGCGATTTGGATACTGAAAAACCA
AACTTTTTACGACCAGTTTACATAGTAGCATAAATCACACAAGTATTACCTTTTGAATTTCTTATGTAATATTTCCACATGACAGGGGAAACGTGTATTTATAGATAATTAATTTGGAAG
ATGACAACGTCAATAATAAAAAACTTCGAAGATAACGATTTTGGATTGACCAACAAGGCGGTGGGGACTGATCTGGTCGAGCGATAGATTTTGGACCACCTATGAGGCTATCATACGTCA
CGTGTCACCTTGTTAGCTAGGCAGCTCGATCACTGCTTTATGTAGACTCCTCGATGAGTTTAGACAAACCACAGCCATTTGTACATGTACTTGTTTGAAGAGCGTGCTACTTGAAGTAAC
ATGAGGAGTAACAAACACGGCATAGATGCATTAGTATAGCGGACGACGTATATGGAGCTACCTACGTACCATGCATGTCGTGGCGTACGTAGTGAAGAAATGTCCAATTTGATTTGTCTG
TGTCTGTCCAGCATCTTTCGGTGGCTTGGTAGGCCGGTTAATTTGTCAGGAGAAACTAGTACGTTCGGAAACAAGTGATATGGATTTGTATAAACATGTCAGGTTAAGAACGATTTAATT
GGTTGTGATTTGGACATATCTGTATATAATAATGATGCACACGCATAATAATACTTCAATCAAAGACGTTTATTAATAATGATGCACACGCATAATAATACTTCAATCAAAGACGTTTAT
TATTTAACTTGATCTTATCCTAATAATGCTCGTGTGTTTGACTCTACTTGACACTGTATAGGGGTGCGACGCGTCGGTGCTGCTGTCCATCAACCCGGGCGGCGGGACGACGGAGCGGGA
CTCGGCGCCCAACAACCCGAGCCTCCGCGGCTTCAACGTCATCGACGCCGCCAAGGCCCTCGTGGAGCAGAGCTGCCCGCGCACGGTCTCCTGCGCCGACATCCTCGCCTTCGCGGCCCG
GGACAGCGTCAACCTCACGGGCACCAACTCGTTCTACCAGGTCCCCTCCGGCCGCCGCGACGGGATCGTCTCGAGAGCGACCGACGCTCTAAACAACCTCCCGGGCCCCAACTCGACGGC
GGACGACCTCATCAAGGGCTTCGCGGCCAAGACCCTGAACGCGGAGGAGATGGTGGTCCTGTCGGGGTCCCACACGCTGGGCCGCTCCCACTGCGCCTCCTTCCTGTTCAAGAACCGGGA
GAGGCTGGCGAGCGGGACCATCAGCCCGGCGTTCCAGGCGCTGCTGGAGGCTCTGTGCCCGCGCAACACGGGACAGTTCACGCCGGTCACCACGGAGATCGATCTCAGCACGCCGGTGGT
GCTGGACAACAACTACTACAGGCTGCTGCCGTTGAACCTGGGCCTCCACTTCTCAGACGACCAGCTCATCCGCAACGGCACGCTCAACGTGTTCGTCAACCAGTTCATCGCTAACCAGAC
GCTGTGGAAGCAGAAGTTCTTTGCGGCCATGATCAAGATGGGCAACATCGAGCCCAAGACCGGGACGCAGGGTCAGGTGCGCCTCAACTGCAGCATCGTCAACGCGGCCTCCTCATCCTC
CTCCGCCGTGGTGATCGAGATGCCCCTGGTCCCGGAAGACCACGATGAGGTCGCCACCAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAGCAGCAACAGCAGCCTGGCCAGTCTGGCGGTGCTGCTCACGGCCGTGCTGTGCCTGCTGCTGCCGGCGGCGAGCCACGCGCAGCTGCGTGTGGGGTTCTACAACACCACCTGC
CCCAACGCCGAGGCGCTCGTCAGGCGGGCCGTCACGGCGGCCTTCGCCAACAATTCCGGCATCGCCGCCGGGCTCATCCGCCTCCACTTCCATGACTGCTTCGTCAAT
GGGTGCGACGCG
TCGGTGCTGCTGTCCATCAACCCGGGCGGCGGGACGACGGAGCGGGACTCGGCGCCCAACAACCCGAGCCTCCGCGGCTTCAACGTCATCGACGCCGCCAAGGCCCTCGTGGAGCAGAGC
TGCCCGCGCACGGTCTCCTGCGCCGACATCCTCGCCTTCGCGGCCCGGGACAGCGTCAACCTCACGGGCACCAACTCGTTCTACCAGGTCCCCTCCGGCCGCCGCGACGGGATCGTCTCG
AGAGCGACCGACGCTCTAAACAACCTCCCGGGCCCCAACTCGACGGCGGACGACCTCATCAAGGGCTTCGCGGCCAAGACCCTGAACGCGGAGGAGATGGTGGTCCTGTCGGGGTCCCAC
ACGCTGGGCCGCTCCCACTGCGCCTCCTTCCTGTTCAAGAACCGGGAGAGGCTGGCGAGCGGGACCATCAGCCCGGCGTTCCAGGCGCTGCTGGAGGCTCTGTGCCCGCGCAACACGGGA
CAGTTCACGCCGGTCACCACGGAGATCGATCTCAGCACGCCGGTGGTGCTGGACAACAACTACTACAGGCTGCTGCCGTTGAACCTGGGCCTCCACTTCTCAGACGACCAGCTCATCCGC
AACGGCACGCTCAACGTGTTCGTCAACCAGTTCATCGCTAACCAGACGCTGTGGAAGCAGAAGTTCTTTGCGGCCATGATCAAGATGGGCAACATCGAGCCCAAGACCGGGACGCAGGGT
CAGGTGCGCCTCAACTGCAGCATCGTCAACGCGGCCTCCTCATCCTCCTCCGCCGTGGTGATCGAGATGCCCCTGGTCCCGGAAGACCACGATGAGGTCGCCACCAGCTGA

Retrieve as FASTA