Entry information : BdiPrx137 (Bradi5g27160)
Entry ID 7997
Creation 2011-02-08 (Toky Ramarohetra)
Last sequence changes 2011-08-12 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx137 (Bradi5g27160)
Name (synonym) BdiPrx137 (Bradi5g27160)
Class Class III peroxidase    [Orthogroup: Prx161]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx137
start..stop
S start..stop
BdiPrx69 342 1e-117 2..319 12..335
BdiPrx136 326 3e-111 3..310 9..320
BdiPrx138 318 2e-108 39..319 37..318
OsPrx59 307 7e-104 3..318 6..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28054234..28054458 225 N° 2 28053334..28054116 783  
complement(join(28053334..28054116,28054234..28054458))


exon

Literature and cross-references BdiPrx137 (Bradi5g27160)
DNA ref. Phytozome 12:   Bd5 (28054458..28053333)
Protein sequence: BdiPrx137 (Bradi5g27160)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (315)
PWM (Da):   %s   36110.97 (34147.9)  
PI (pH):   %s   5.65 (5.65) Peptide Signal:   %s   cut: 21 range:21-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPLGMIVVVAALLSLPSALSLPSLISMPTAGKVDLALTDSCRDDIVRNAVQAARSSDIGVTAGLLRISFHDCFPQGCDGSILLTGPNTEQDIRPQNGGLRQTALDLIESIRDKVHRACGWRSVSCTDIMNLATREAVKQSGGPDYTVPTGRLDSLEPAPRTAVEQSLPAPFFDVSQLLENFGRKGMENLDLVALSGAHTIGKASCGSFSNRFGENTAFMQALSKTCRDIPGWRQDLDVTTPNDFDNAYFVNLLQGKGLLTSDMALVNDGRTRWLVEGFAGNHWWFFGQFGTSMSKLAHMQGDQGRNGQIRDNCTRKNSGLAQDLVHAVEEFVASV*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction. Incrrect prediction from phytozome and ensembl (Part of exon 3 is missing due to a extra nt/ GTGAAGCAGTCA"c"GGG).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGTTGGGCATGATAGTCGTCGTCGCCGCGCTGCTCTCTCTCCCGTCAGCCTTGTCCTTGCCGTCCTTGATCTCTATGCCCACCGCCGGCAAGGTAGATCTTGCTCTTACTGACTCG
TGCCGTGACGACATTGTGCGCAACGCCGTTCAGGCCGCGCGTAGCAGTGACATCGGTGTCACCGCCGGCCTCCTCCGCATCTCCTTCCACGATTGCTTCCCTCAG
GTACGATGGTTACGA
TATATCATCGCTTTCTCTATTGATCACCTTTGAACTGCCATGGGCAGCCTTTAATTTATCGGATCTCACTGACCCCTCATATATACATGTTTTCTGATGTAGGGATGCGACGGGTCGATC
CTACTGACGGGACCCAACACCGAGCAAGATATCAGGCCACAGAACGGGGGTCTTCGTCAAACCGCTCTAGATCTCATCGAAAGCATTCGTGACAAGGTGCACCGTGCCTGCGGGTGGCGC
TCCGTCTCCTGCACTGACATCATGAACCTGGCCACCCGGGAGGCGGTGAAGCAGTCAGGGGGCCCGGACTACACCGTGCCTACCGGCCGGCTCGACAGCCTCGAGCCGGCTCCACGCACG
GCCGTCGAGCAGTCCTTACCGGCACCCTTCTTCGACGTCAGCCAGCTCCTGGAAAACTTCGGGAGGAAAGGCATGGAGAACCTCGACCTTGTGGCGCTCTCCGGCGCGCACACCATCGGC
AAGGCCAGCTGCGGCAGCTTCAGCAACCGGTTCGGCGAGAACACGGCGTTCATGCAAGCGCTCTCCAAGACCTGCAGGGACATCCCTGGCTGGAGGCAGGATTTGGACGTGACGACCCCC
AACGACTTCGACAACGCCTACTTCGTCAACCTCTTGCAGGGGAAGGGGCTGCTCACCTCCGACATGGCGCTCGTCAACGATGGCCGCACCCGGTGGCTCGTCGAGGGCTTCGCCGGCAAC
CATTGGTGGTTCTTTGGCCAGTTCGGCACCTCCATGAGCAAGCTCGCGCATATGCAGGGAGACCAGGGGAGGAACGGCCAGATCCGCGATAACTGCACCAGGAAGAACTCTGGACTGGCC
CAAGATCTCGTCCATGCCGTCGAGGAGTTCGTGGCCTCCGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCGTTGGGCATGATAGTCGTCGTCGCCGCGCTGCTCTCTCTCCCGTCAGCCTTGTCCTTGCCGTCCTTGATCTCTATGCCCACCGCCGGCAAGGTAGATCTTGCTCTTACTGACTCG
TGCCGTGACGACATTGTGCGCAACGCCGTTCAGGCCGCGCGTAGCAGTGACATCGGTGTCACCGCCGGCCTCCTCCGCATCTCCTTCCACGATTGCTTCCCTCAG
GGATGCGACGGGTCG
ATCCTACTGACGGGACCCAACACCGAGCAAGATATCAGGCCACAGAACGGGGGTCTTCGTCAAACCGCTCTAGATCTCATCGAAAGCATTCGTGACAAGGTGCACCGTGCCTGCGGGTGG
CGCTCCGTCTCCTGCACTGACATCATGAACCTGGCCACCCGGGAGGCGGTGAAGCAGTCAGGGGGCCCGGACTACACCGTGCCTACCGGCCGGCTCGACAGCCTCGAGCCGGCTCCACGC
ACGGCCGTCGAGCAGTCCTTACCGGCACCCTTCTTCGACGTCAGCCAGCTCCTGGAAAACTTCGGGAGGAAAGGCATGGAGAACCTCGACCTTGTGGCGCTCTCCGGCGCGCACACCATC
GGCAAGGCCAGCTGCGGCAGCTTCAGCAACCGGTTCGGCGAGAACACGGCGTTCATGCAAGCGCTCTCCAAGACCTGCAGGGACATCCCTGGCTGGAGGCAGGATTTGGACGTGACGACC
CCCAACGACTTCGACAACGCCTACTTCGTCAACCTCTTGCAGGGGAAGGGGCTGCTCACCTCCGACATGGCGCTCGTCAACGATGGCCGCACCCGGTGGCTCGTCGAGGGCTTCGCCGGC
AACCATTGGTGGTTCTTTGGCCAGTTCGGCACCTCCATGAGCAAGCTCGCGCATATGCAGGGAGACCAGGGGAGGAACGGCCAGATCCGCGATAACTGCACCAGGAAGAACTCTGGACTG
GCCCAAGATCTCGTCCATGCCGTCGAGGAGTTCGTGGCCTCCGTTTGA

Retrieve as FASTA