Entry information : SbAPx09 (Sobic.006G204000.1[2.1] / Sb06g027520[1.4])
Entry ID 7999
Creation 2011-02-09 (Toky Ramarohetra)
Last sequence changes 2011-03-03 (Nizar Fawal)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-04-28 (Christophe Dunand)
Peroxidase information: SbAPx09 (Sobic.006G204000.1[2.1] / Sb06g027520[1.4])
Name (synonym) SbAPx09 (Sobic.006G204000.1[2.1] / Sb06g027520[1.4])
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Seedlings
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbAPx09
start..stop
S start..stop
ZmAPx10 688 0 1..351 1..351
SiAPx04 630 0 1..351 1..353
OsAPx10 570 0 1..351 1..348
BdiAPx08 538 0 1..351 11..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 56404707..56404802 96 N° 2 56404894..56405010 117 N° 3 56405308..56405392 85 N° 4 56405489..56405523 35
N° 5 56405617..56405682 66 N° 6 56405763..56405802 40 N° 7 56405939..56406064 126 N° 8 56406182..56406288 107
N° 9 56406427..56406564 138 N° 10 56406720..56406854 135 N° 11 56406943..56407053 111  
join(56404707..56404802,56404894..56405010,56405308..56405392,56405489..56405523 ,56405617..56405682,56405763..56405802,56405939..56406064,56406182..56406288,564 06427..56406564,56406720..56406854,56406943..56407053)


exon

Literature and cross-references SbAPx09 (Sobic.006G204000.1[2.1] / Sb06g027520[1.4])
DNA ref. Phytozome 12:   Chr06 (56404721..56407067)
Protein sequence: SbAPx09 (Sobic.006G204000.1[2.1] / Sb06g027520[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351
PWM (Da):   %s   38137.48  
PI (pH):   %s   8.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGASFLSTAPLVARGVAACSSISTPTRRHPHIRVCCRADAEGSEAAAHEERLRFRRRDFIGTCVGSAIGLELIDGSTRFSGVATAADLIERRQRSEFQSKIKDTLYVAIAKPELVPSLLTLALNDAMTYDKATKTGGANGSIRLETSRPENSGLSAALDLLTEAKKEIDSFSKGGPISFADLIQFAAQSALKRSFLDAAIAKCGGNEEKGRTLYSAYGSNGWGLFDRTFGRADAQEADPEGRVPEWSKASVQEMKDRFVAVGLGPRQLAVMSAFLGPDQAATEERLIADPDCRPWVEKYQRSRETVSRTDYEVDLITTLTKLSSFGQNINYEAYTYPKQKIDLGKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic. 6 ESTs. cultivar="BTx623"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGAGCGAGCTTCCTCTCGACCGCGCCGCTCGTTGCCCGCGGCGTCGCTGCCTGCTCTTCCATTTCGACTCCGACGCGGAGGCACCCGCACGTACGTACGCCCCCCGAACTTACT
GTTTTGCCCGTGCAGATTCCATTTCAGCTCCGACGTAATCGCGTGATCCTTGGTTTTGCCTGCGCAGATTCGAGTTTGCTGCCGGGCTGACGCTGAGGGCTCGGAGGCTGCTGCTCATGA
AGAGCGTCTGCGATTCCGCCGGAGAGATTTCATTGGCACCTGCGTCGGGAGCGCCATTGGTTTG
GTAAGTGGTAGTGCTACCATCCTGACAAAAGAACAATGCCCTTGTGCATTGGTGTT
ACAGAAGTAAACAAATGTAGCATTATGGGAGAGCTTCAAGTTGTTGCCCCAGCAAACTTTTTATCTCAGCTGCATCTAGTCACGCTCGAACTTATGCTGATGCTGAAAAGTATTATTCGC
TAATTTGTTCTGAGAGGAAAACAATGTACAAATGTGGTTATACTGTTTTAAGAGGAAAGACACCTTTTGTCTCAGTTCAGAGGTGATAAGCTGAACTTCGTTTATTTATGTCTTGGGTTA
GGAATTGATCGACGGTTCTACAAGATTCTCTGGAGTGGCTACTGCAGCTGATCTCATTGAGCGTAGACAACGGTCGGAGTTCCAGTGTAGGTCATCTCATATTGTTAGTTCCATTGGCCC
ACTTGAATGCTAATGTTTCATTCTCACCATCGAAATTGAAGTCTTTTGACTGTTTTTTGCAGCAAAAATCAAAGATACGCTCTACGTAGCCATAAAGGTGAGACGCCTTAGTTTGTTGTA
CCTGGTGTTTTTCTTTCATCTATCTATCACTTCTGTTGCCTGAAACTGTGAACCTGATAATCTTTTGAAGGCTAAGCCAGAGCTCGTTCCATCATTGTTGACCTTGGCACTGAATGATGC
CATGACATATGACAAG
GTCTGGTATCTGAATGGCTTTATATCATTAGCATTTGGGTCCCTCTGTTGGTTTAGAGAGTTGGTTTAATTCTTCTGCAGGCCACAAAAACTGGAGGAGCAAAT
GGGTCTATCAGGCTAG
GTAGCAATTTCTTTTTCCTTTTCTCTTCTTCAGTTCTTCAGTTTGTTTTTTGTTTTGAGAGAAGAAAATGTTCAGCTGGAGATAATCCGTTGCGTTGCTCCACC
ATTTAATACTTAATTTTTCAAATAAAGCCCAGAAACAAGCAGACCTGAAAACAGTGGGCTCTCTGCTGCATTGGATTTGCTGACTGAAGCCAAAAAGGAGATAGATTCCTTTTCCAAGGG
AGGTCCCATTTCATTTGCAGATCTGATCCAGTTTGCAG
GTTCGACAATTTCCAGTGCAGTTTTACTACCATTATGAAACTTGTTGATCTTTACTGGCAAGCTCTTCCGTATATTGGCTTG
TTTTAAATTAAGAATTTTGTTTTTTCTTGAAACAGCACAATCAGCACTGAAGAGATCATTTCTTGACGCGGCCATTGCCAAATGTGGTGGAAATGAAGAGAAGGGAAGAACCCTATACTC
TGCATATGGTTCAAATGGGCAG
GTATGTACTGTGCCACATTGCTCCTTATGTCACATGATGCTTCATATGTTCAGTATACACTCTGTACAAGCTGCTCCTTATTTAACGTTTAAAATTAT
ATTTTTTCTCTACGTTTGTTTTGACTATTTGCAACCACAGTGGGGTCTGTTCGATAGAACATTCGGGAGAGCAGATGCACAGGAAGCAGATCCAGAGGGAAGAGTGCCTGAGTGGAGCAA
AGCTTCTGTGCAGGAGATGAAGGATAGGTTCGTCGCTGTTGGGCTGGGTCCTCGCCAG
GTTACTACTACCACATCCTTATTAGATTGCTGAAATAAATTAACTGTCTTAACTTATCTCAT
TATTGTCATGACCATGAGAGAGAGAGAGAGAGAGAGAGAGAGCAAAAACCATGAACCAGTCTCACGTTTAATAGAAGATGGCTCTTTTTGCAGCTTGCTGTTATGTCAGCATTCCTTGGA
CCTGACCAGGCTGCTACCGAGGAACGACTGATAGCTGATCCAGATTGCCGTCCATGGGTGGAGAAGTACCAGCGGAGCCGCGAGACTGTCTCCCGGACTGACTACGAA
GTATGATTCATT
GATGCGTATGTGCTGGCAATGCTCGGTATATCTTCTAGTGTTTATTCTAACTTGTGCTTATTTGTCTGTATGGCAGGTTGACCTGATTACCACACTCACAAAGCTGAGCTCCTTCGGCCA
GAACATAAACTATGAAGCCTACACATACCCTAAGCAAAAGATTGACCTGGGCAAATTGAAACTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGGAGCGAGCTTCCTCTCGACCGCGCCGCTCGTTGCCCGCGGCGTCGCTGCCTGCTCTTCCATTTCGACTCCGACGCGGAGGCACCCGCACATTCGAGTTTGCTGCCGGGCTGAC
GCTGAGGGCTCGGAGGCTGCTGCTCATGAAGAGCGTCTGCGATTCCGCCGGAGAGATTTCATTGGCACCTGCGTCGGGAGCGCCATTGGTTTG
GAATTGATCGACGGTTCTACAAGATTC
TCTGGAGTGGCTACTGCAGCTGATCTCATTGAGCGTAGACAACGGTCGGAGTTCCAGT
CAAAAATCAAAGATACGCTCTACGTAGCCATAAAGGCTAAGCCAGAGCTCGTTCCATCATTG
TTGACCTTGGCACTGAATGATGCCATGACATATGACAAG
GCCACAAAAACTGGAGGAGCAAATGGGTCTATCAGGCTAGAAACAAGCAGACCTGAAAACAGTGGGCTCTCTGCTGCATTG
GATTTGCTGACTGAAGCCAAAAAGGAGATAGATTCCTTTTCCAAGGGAGGTCCCATTTCATTTGCAGATCTGATCCAGTTTGCAG
CACAATCAGCACTGAAGAGATCATTTCTTGACGCG
GCCATTGCCAAATGTGGTGGAAATGAAGAGAAGGGAAGAACCCTATACTCTGCATATGGTTCAAATGGGCAG
TGGGGTCTGTTCGATAGAACATTCGGGAGAGCAGATGCACAGGAAGCA
GATCCAGAGGGAAGAGTGCCTGAGTGGAGCAAAGCTTCTGTGCAGGAGATGAAGGATAGGTTCGTCGCTGTTGGGCTGGGTCCTCGCCAG
CTTGCTGTTATGTCAGCATTCCTTGGACCT
GACCAGGCTGCTACCGAGGAACGACTGATAGCTGATCCAGATTGCCGTCCATGGGTGGAGAAGTACCAGCGGAGCCGCGAGACTGTCTCCCGGACTGACTACGAA
GTTGACCTGATTACC
ACACTCACAAAGCTGAGCTCCTTCGGCCAGAACATAAACTATGAAGCCTACACATACCCTAAGCAAAAGATTGACCTGGGCAAATTGAAACTGTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTTATCCTCG CGAGCTACTG CCGCACCAGC CTGCGAGCCT CCATTGAGAG CGCTCAACCA GCCATTGAGA GCGTCAGAGG TCAGTAGAGA AATGGCGGGA GCGAGCTTCC TCTCGACCGC  GCCGCTCGTT GCCCGCGGCG TCGCTGCCTG CTCTTCCATT TCGACTCCGA CGCGGAGGCA CCCGCACATT CGAGTTTGCT GCCGGGCTGA CGCTGAGGGC TCGGAGGCTG CTGCTCATGA  AGAGCGTCTG CGATTCCGCC GGAGAGATTT CATTGGCACC TGCGTCGGGA GCGCCATTGG TTTGGAATTG ATCGACGGTT CTACAAGATT CTCTGGAGTG GCTACTGCAG CTGATCTCAT  TGAGCGCAGA CAACGGTCGG AGTTCCAGTC AAAAATCAAA GATACGCTCT ACGTAGCCAT AAAGGCTAAG CCAGAGCTCG TTCCATCATT GTTGACCTTG GCACTGAATG ATGCCATGAC  ATATGACAAG GCCACAAAAA CTGGAGGAGC AAATGGGTCT ATCAGGCTAG AAACAAGCAG ACCTGAAAAC AGTGGGCTCT CTGCTGCATT GGATTTGCTG ACTGAAGCCA AAAAGGAGAT  AGATTCCTTT TCCAAGGGAG GTCCCATTTC ATTTGCAGAT CTGATCCAGT TTGCAGCACA ATCAGCACTG AAGAGATCAT TTCTTGACGC GGCCATTGCC AAATGTGGTG GAAATGAAGA  GAAGGGAAGA ACCCTATACT CTGCATATGG TTCAAATGGG CAGTGGGGTC TGTTCGATAG AACATTCGGG AGAGCAGATG CACAGGAAGC AGATCCAGAG GGAAGAGTGC CTGAGTGGAG  CAAAGCTTCT GTGCAGGAGA TGAAGGATAG GTTCGTCGCT GTTGGGCTGG GTCCTCGCCA GCTTGCTGTT ATGTCAGCAT TCCTTGGACC TGACCAGGCT GCTACCGAGG AACGACTGAT  AGCTGATCCA GATTGCCGTC CATGGGTGGA GAAGTACCAG CGGAGCCGCG AGACTGTCTC CCGGACTGAC TACGAAGTTG ACCTGATTAC CACACTCACA AAGCTGAGCT CCTTCGGCCA  GAACATAAAC TATGAAGCCT ACACATACCC TAAGCAAAAG ATTGACCTGG GCAAATTGAA ACTGTAAAGA TATTTGCCAG GCACCTGCAT CGGCCATACC CAGGATTCAG GAGCTCATAA  TATGGTAGGC TCTGGCTGCT AAAGAGTGAT TTGATTCGGC ACTGACGTTC ATGTATTGGC TACTCATCAG CTGTCAGACA TTCTTCCCCG GCAATTAGGA TGGTCCCTGT ACATGGTGAA  TTTGGTTCTC CGATTTTGTT TTGTGTGAGC CAAACGCTTG TGAGAAATGT GGTGTTGTGT AAATTCCTTT ACGTACGTGA GACTATTGAA GAATTAATAG AAACAAAGTG CAAGTTATAT 
GACTG 

Retrieve as FASTA