Entry information : LePrx76 (TAP1 / TMP1 / Solyc02g079500.2.1[2.3])
Entry ID 8
Creation 2006-12-27 (Christophe Dunand)
Last sequence changes 2012-05-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-08-26 (Christophe Dunand)
Peroxidase information: LePrx76 (TAP1 / TMP1 / Solyc02g079500.2.1[2.3])
Name (synonym) LePrx76 (TAP1 / TMP1 / Solyc02g079500.2.1[2.3])
Class Class III peroxidase    [Orthogroup: Prx056]
Taxonomy Eukaryota Viridiplantae Streptophyta Solanaceae Solanum
Organism Lycopersicon esculentum (Tomato)    [TaxId: 4081 ]
Cellular localisation N/D
Tissue types Callus
Cell culture
Flower buds
Flowers
Roots
Seedlings
Inducers Abscissic acid treatment
Suberization
Repressor N/D
Best BLASTp hits
Perox score E-value LePrx76
start..stop
S start..stop
StPrx72 712 0 1..364 1..363
LePrx75 634 0 1..364 1..363
StPrx52 622 0 1..364 1..358
NtPrx27-1A 536 0 1..364 1..358
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 428..772 345 N° 2 1635..1832 198 N° 3 2115..2666 552  
join(428..772,1635..1832,2115..2666)


exon

Literature and cross-references LePrx76 (TAP1 / TMP1 / Solyc02g079500.2.1[2.3])
Literature Roberts E., Kolattukudy P.E.; Molecular cloning, nucleotide sequence, and abscisic acid induction of a suberization-associated highly anionic peroxidase. Mol. Gen. Genet. 217:223-232(1989).
Protein ref. UniProtKB:   P15003
DNA ref. GenBank:   X15853.1
Protein sequence: LePrx76 (TAP1 / TMP1 / Solyc02g079500.2.1[2.3])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (344)
PWM (Da):   %s   38594.05 (36495.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.73 (4.56) Peptide Signal:   %s   cut: 21 range:21-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFRLSHLSLALSFVALALAGVAIYRNTYEAIIMKNGSLLKNVSPDFDSLESGVASILTLNNNKKRNSDKYLRQQLTPEACVFSAVRAVVDSAIDAETRMGASLIRLHFHDCFVDGCDGGILLDDINGTFTGEQNSPPNANSARGYEVIAQAKQSVINTCPNVSVSCADILAIAARDSVAKLGGQTYSVALGRSDARTANFSGAINQLPAPFDNLTVQIQKFSDKNFTLREMVALAGAHTVGFARCSTVCTSGNVNPAAQLQCNCSATLTDSDLQQLDTTPTMFDKVYYDNLNSNQGIMFSDQVLTGDATTAGFVTDYSNDVNVFLGDFAAAMIKMGDLPPSAGAQLEIRDVCSRVNPTSVASM*

Retrieve as FASTA  
Remarks Complete sequence from 16 ESTs and genomic (chromo 2, introns 1 and 2). Strain="Castlemart II".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTCGTTTGAGTCATTTGAGTCTTGCATTGAGTTTTGTGGCACTTGCACTTGCAGGTGTTGCTATTTATAGAAATACTTATGAAGCCATCATCATGAAAAACGGTTCACTCCTC
AAAAATGTTTCTCCAGATTTCGATTCGTTGGAATCAGGCGTAGCCAGTATTTTAACCTTAAATAATAATAAGAAGAGAAATTCAGACAAGTACTTGAGACAGCAACTAACTCCGGAGGCA
TGCGTTTTCTCAGCTGTACGAGCAGTTGTGGACAGTGCTATTGATGCAGAAACTCGCATGGGAGCTTCTCTCATTCGTCTCCACTTTCATGACTGCTTCGTTGAT
GTAAATATATATTTC
CTTCGCTCTTTTTTTATCGTATTTGATTATGCACAAAATTTTATTTGAAGTCACTTAAATATTTTATGCTTGTTCAAACAAATTTGAAAATTCTTTCAGTTTTTCCTGAACTCACAATGC
ATGCAGTCAATTACTTTACTAGGGAAAATGCACAAGTACATTCTCAACCTATGTCCGAAATTACAGAGACACACTTATATTATACTAAGGTTCTATTACTCCCCTGAACTTATTTTATAA
GTAATATTCTACCTAGCTTGAAAAAAAAGTCAACCTGCGTAAGGCCAACAAGATAGTGTCACGTAGGCCGAAAAAAAGTAAAAAATTATTAATAAAATAAGTTAAGTAAAATAATAGGAC
CTTAGTATAGTATAAGCGTGTCTCTAAAATTTCGGGTATAGGTTAAAGGGACTACTTAAATTGAAATGAAAAGAGTAGAGGGATATCATTTTTTAAGACAGGCTAAAAAGAGTACAATGT
TAGGTGTAGCATATTAATTGAATCCGAGTCCTTTTCCTCTTATTAATTAAACCTGGCCGTATGATCATATTTTTCTTTCATAAATAAATAAATTGTTGAAAGATCTGAGGCTACGAACTC
CAAATTAAAATTATAATGCCATACTTGTTGTTTTAAATCGCAAATATTTAAAAAAAAAATACTTTTTCTTTTGAACTCCCCGTCAAGTAAAATATCTTCGCACACATTTTGCTTCTACAT
GAACTCCAAAAACTTTGAAAAGTCTAGTCTGCTTTCCAGTTTTATTTTATTTTAGATCTTCTGCAGTTGATTTATGTATTTGACTAATTATACCTCTCTCGTTTTCTTTTTTATTACGAA
AAATAAGGGTTGTGATGGAGGTATTCTGCTAGATGATATTAATGGAACATTTACAGGGGAACAAAACTCACCACCCAACGCCAACTCAGCCAGAGGTTATGAAGTAATAGCACAAGCTAA
ACAAAGTGTCATAAACACATGCCCCAACGTATCTGTATCTTGTGCCGACATATTAGCTATTGCTGCTCGTGATTCTGTTGCTAAA
GTAAGTCTATCATTCATTTTACAGTTTGATAATTT
CTACCAAAATTAATTACGAATAGTAACAAATGGATATTTAATCAAACTCTAAAGTCATCGTGGAAGTTGAGAAATGTTCAAAGAGATGACCAAATTCCACATCCACAATCAATGTGGAAA
TTGTGACACCTCGCCTGTGGGCGTCTAACATTTAATAGATGAAGCATTGTATTTATTTAGGTTATGATGATATGACAAAGAAATTGACTTGGGCTAACTCAAACTCTGTTTTATTGGTAT
TTGACAGTTAGGAGGACAAACTTATAGCGTTGCATTAGGGAGAAGCGATGCTAGAACTGCCAACTTTAGTGGTGCTATAAATCAACTTCCAGCTCCATTCGACAACCTAACAGTCCAAAT
ACAGAAATTCAGCGACAAAAATTTCACCCTCCGTGAAATGGTTGCACTAGCTGGTGCACACACGGTAGGTTTCGCCAGGTGTTCCACAGTTTGCACCAGCGGTAACGTTAATCCTGCCGC
ACAACTCCAATGCAACTGCTCCGCCACGCTAACTGATTCTGATTTGCAACAATTGGATACTACTCCTACTATGTTCGACAAAGTTTACTACGATAACTTAAACAGCAACCAAGGCATAAT
GTTTTCAGATCAAGTTTTGACCGGGGATGCTACAACTGCTGGTTTTGTAACGGATTATAGCAACGATGTGAACGTTTTCCTTGGAGATTTTGCTGCTGCCATGATCAAGATGGGAGACTT
GCCCCCCTCCGCCGGCGCTCAATTGGAAATTCGTGATGTTTGTAGCAGGGTTAATCCCACTTCAGTGGCTTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTCGTTTGAGTCATTTGAGTCTTGCATTGAGTTTTGTGGCACTTGCACTTGCAGGTGTTGCTATTTATAGAAATACTTATGAAGCCATCATCATGAAAAACGGTTCACTCCTC
AAAAATGTTTCTCCAGATTTCGATTCGTTGGAATCAGGCGTAGCCAGTATTTTAACCTTAAATAATAATAAGAAGAGAAATTCAGACAAGTACTTGAGACAGCAACTAACTCCGGAGGCA
TGCGTTTTCTCAGCTGTACGAGCAGTTGTGGACAGTGCTATTGATGCAGAAACTCGCATGGGAGCTTCTCTCATTCGTCTCCACTTTCATGACTGCTTCGTTGAT
GGTTGTGATGGAGGT
ATTCTGCTAGATGATATTAATGGAACATTTACAGGGGAACAAAACTCACCACCCAACGCCAACTCAGCCAGAGGTTATGAAGTAATAGCACAAGCTAAACAAAGTGTCATAAACACATGC
CCCAACGTATCTGTATCTTGTGCCGACATATTAGCTATTGCTGCTCGTGATTCTGTTGCTAAA
TTAGGAGGACAAACTTATAGCGTTGCATTAGGGAGAAGCGATGCTAGAACTGCCAAC
TTTAGTGGTGCTATAAATCAACTTCCAGCTCCATTCGACAACCTAACAGTCCAAATACAGAAATTCAGCGACAAAAATTTCACCCTCCGTGAAATGGTTGCACTAGCTGGTGCACACACG
GTAGGTTTCGCCAGGTGTTCCACAGTTTGCACCAGCGGTAACGTTAATCCTGCCGCACAACTCCAATGCAACTGCTCCGCCACGCTAACTGATTCTGATTTGCAACAATTGGATACTACT
CCTACTATGTTCGACAAAGTTTACTACGATAACTTAAACAGCAACCAAGGCATAATGTTTTCAGATCAAGTTTTGACCGGGGATGCTACAACTGCTGGTTTTGTAACGGATTATAGCAAC
GATGTGAACGTTTTCCTTGGAGATTTTGCTGCTGCCATGATCAAGATGGGAGACTTGCCCCCCTCCGCCGGCGCTCAATTGGAAATTCGTGATGTTTGTAGCAGGGTTAATCCCACTTCA
GTGGCTTCTATGTGA

Retrieve as FASTA