Entry information : AtPrx04(At1g14540 / PER4 / AtP46)
Entry ID 80
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2020-03-04 (Christophe Dunand)
Peroxidase information: AtPrx04(At1g14540 / PER4 / AtP46)
Name AtPrx04(At1g14540 / PER4 / AtP46)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Senescing leaves
Inducer Senescence
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx04
start..stop
S start..stop
AlyPrx04 617 0 1..315 1..316
BstrPrx77 598 0 1..315 1..316
AhalPrx45 598 0 1..315 1..323
CagraPrx58 597 0 1..315 1..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4975403..4975600 198 N° 2 4975099..4975290 192 N° 3 4974712..4974877 166 N° 4 4974233..4974624 392
complement(join(4974233..4974624,4974712..4974877,4975099..4975290,4975403..4975 600))


exon

Literature and cross-references AtPrx04(At1g14540 / PER4 / AtP46)
Literature REFERENCE 1 Rasul S, Dubreuil-Maurizi C, Lamotte O, Koen E, Poinssot B, Alcaraz G, Wendehenne D, Jeandroz S. Nitric oxide production mediates oligogalacturonide-triggered immunity and resistance to Botrytis cinerea in Arabidopsis thaliana. Plant Cell Environ. 2012 Aug;35(8):1483-99.
REFERENCE 2 Fernández-Pérez F, Vivar T, Pomar F, Pedreño MA, Novo-Uzal E. Peroxidase 4 is involved in syringyl lignin formation in Arabidopsis thaliana. J Plant Physiol. 2015 Mar 1;175:86-94.
.
Protein ref. UniProtKB:   Q9LE15
DNA ref. Phytozome 12:   Chr1 (4975600..4974233)
mRNA ref. GenBank:   NM_101321.3
Cluster/Prediction ref. Phytozome Gene 12:   19655290 UniGene:   At.41966
Omic ref. AtProteome:   At1g14540 ATTED-II:   At1g14540 e-FP Browser:   At1g14540 ePlant:   At1g14540 Genevestigator:   At1g14540 TAIR:   At1g14540
Protein sequence: AtPrx04(At1g14540 / PER4 / AtP46)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   315 (296)
PWM (Da):   %s   34275.09 (32181.0)  
PI (pH):   %s   7.87 (7.68) Peptide Signal:   %s   cut: 20 range:20-315
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIFKILVLLLSLCCFSQAQLSPTFYDQTCQNALSTIRSSIRTAISRERRMAASLIRLHFHDCFVNGCDASVMLVATPTMESERDSLANFQSARGFEVIDQAKSAVESVCPGVVSCADIIAVAARDASEYVGGPRYDVKVGRRDSTNAFRAIADRDLPNFRASLNDLSELFLRKGLNTRDLVALSGAHTLGQAQCLTFKGRLYDNSSDIDAGFSSTRKRRCPVNGGDTTLAPLDQVTPNSFDNNYYRNLMQKKGLLESDQVLFGTGASTDSIVTEYSRNPSRFASDFSAAMIKMGDIQTLTGSDGQIRRICSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns), 7 ESTs
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TATCAACCAA AAAAGAAAAA GTATCATGGT ACATAATATA TACATGTATG CATATGAATT GGCTAATATC TATTAATCCA TATGATGGCA GGCCTAGATT TATTATAATA ATAATATTTT  TTTTTGATAT CGTGACCAAA GCATAACATA ATGGAGATTT CGAAGTCCAA ACCATAATAC TTAACGGGGT CGTACGTACT AAACCAAATA TGTTTTCAAA CATTTTTGTC AAAAAAAAAT  TATATATATT TACTTTCCTA TTTTAGGGGT GTCATTTTCA TCTAGCTCTT CTTCAAACTA GGTCGTCTGC CCATATGGGT GAGTATATAT ATGTGTTTAG TAAGTTTCAT TTTCCTTTGA  TGAAAAGGTC AATTCAACTA TGTTCGAATA TGTTACTAGA TCAGTGCATG TATGGAACTG TCTTACATGA TCTAATTAGA CTAAAAGCTG TCCTCCATTA GAAATTCACA CCAAATGACG  TGTGTTTATA TATTGATTAA GATTACCGGT CAAATTGAAA TATTAATATA TTCGTTTATA TAATTCTTTA GAAAAAATGA AGAAAACTCA CTACTACGCA CTGAGAAAAA AACGATATCA  TCAACATGAA CTTCAGGCAA ATTGGTTCCT TTTTATCTTT TTTGTTTTTT TGTTTTTACC GTCGTCTGAG GTTAATTTTA CTTGTCAATA ATTATTTGTA TTGCTATATA TCCACACATT  CAAACTTAAG TTGGGCTGAA ATTAAAATAC CTTCATGATA ACTCTTAGTA CGTAAGACAT ATACATATAT TTTCTTTAAC AAAAAAAAAG AAATATACAT ATATTTTGCA GAGAATAAAA  TTCACTCCCT CGTATCAAAT ATAGATATTG ATACAAAGCT TACAAAACGA ACTTTATTTG TAAATCAAAT GGTGCTTGTC GACGTTGTCG TCTTTGAGCC TATTGATTAG TTGTCCGCGA  GATTCAGTAA ACATTTGAAT TAATATATGC ATTTTTTTGG GAGATGGGTA AAACAATAGT CAAACAGAAA TCAAGATATA ATCATAACAT AATGATATTT TAGATATTTG TTCTATATCG  TTTTCATCTG AAAGATCCTG ATGAGAATTT AAGAAAATGG AATGGAATTG AAAAAATAAA AGGATTCAAA GGTGTAAATG TAAATGGAAC TTAATTTTTT TAATTATTTA CTGAAACAAA  CTAAGAAGCT TACCTAAATA GGAAAGCAAC GAACAAGTTA AGAAGCACTT GTGGCTAGTG GTTACGGTAT GGACAATGTT ACATCACATT ATCCTTACGA AAGATTCTTT CTGACTATTT  TATAAAAGTC AAAAGTCAAT TTTCAAAATT CCGCGTAAGC GTAACGGTTT TAATTATTAA GTTATGGTTT GGTCAACGTA GGCCAGCTTC AACAAAATCT AAACCAAATT CGGATACTTT  ATTATTTCAG TTTTTTCGTT AATGCAAATG TCAAGTAATT GCAAGAGTTG AAAATAGAAA GCGAAATAAT CAAATACCCC GAACAAACAC TCTTTTGTTG AAAACGAATA TCTATAATGT  ACAAATTAAG ATTGTTCAAT CCAATAAAAG ATTTAGTTCT TTATCAAAAT AAATTTTTAT GAGAGTTCAA TAATCATCGC AGAAACTTAT TATATAATTT CAGATTGCTA AATCCAATAT  GAGAATGTAA TCGTTTCTAA AAATAGTTAA CTCTTATCCA ATAATAATTA TTATGTAGAC AAAGATATTA GGTGCCATAT TAAAGGAGAA AAGGCAACTA TTGGAAAAGG TCGTCGGGTG  GTGTCTACGC GCTATCGCAG AAAAAAGTGA CCATGATTGG TTACTTATTT CGCTCCTATA TATATAAGAC GTATTTCGTC CCATTTCGAA AACTCACATC AAGTTTCTTC AATTCATTAA 
ATCACTTCTC AATTAGCTCT TACGAAATTC TTTTCATTAC TAAAAAAATT TACAAACAAA AGTCTCTTGT AATAAGCTAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGAGTTATT ACCTACTTGT CTTCAACGAG AAAAGTTCGA ACCTTGAAAA TTCATGTTAT TATATTTACG TGTATACCCC ATTTGATTCA TTTTTGTAAT TGTGTGTAAC TAAAATTCCT  GCAGCGATAA TTCGTTTGTT ATTTGAATAT ATGGAATAAT AAATATTTTG GAATATATAA GGTACCAAGG AAAGTGTTAA TAATTAAATC CATAGCATTT TTTATTAGTT TCGTCATTGT  TAAATTAGTC ACAATCTCTC TAAAGTTCAT TAAAAAGTCC AGCTAGCATT AATTTATCCA CGTATACATA CACGTGGAAC TATGATAACA ACGTTGCGTG TCGGTCACCA GAACATCTCC  ACACGGAGAG AACCACCGGC TATATCCGGT TACTTTTTCA ATCTCCTCTT CAGTTTCTTC CACGTCATTC TAAGTATTCC CTGTCACGGC CGGTCTCAAA TCTTATTTCG GGTAATACTA  TAAATACCTT AAAACAAAAA AAAATGGAAG AAAAATAAAA TAAAAATCTA GGAAGGAGAA GGAGAGAGGA GAAGTGATTC GATCGATTCT CTTTTTGGTG ATCGAAGCTA AATCTATAAG  GAATTTGAAT CTTTGTATGT GTTTTTTTCG TGGAGATGAG AAGCGGCGGC TTGGAAATGA TGTCATCTTC AGCAATCGTA GCGTTTAATT TGAAGGAGGG TAAGAATTGG TGGTGGGATG  TGAATGAATC TCCGGTGTGG CAGGATCGTA TCTTCCATGT TCTTGCTGTT CTATATGGAA TCGTTTCCGT CATTGCTGTG GTACCGTTTA CTTGTCCTTC TGGTTTTGAA TTGGGATTGG  AATTAGGGAA TGTGTTGATT TGGAATCGGA AGATTAGGCA TTTAAGGATA TGAAATTGAG GAAATAGTTG TTGTATGGAG TGTTGATTAG AGAAAAAAAC CCTAAATTGA TTAAAGTTTC 
ATTTGTTTTT TTGTAGATTC AATTGGTAAG AATACAATTG 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCTTCAAGATTCTTGTATTGTTGTTGAGTTTGTGTTGTTTCAGTCAAGCACAACTTTCTCCTACTTTCTACGACCAAACTTGTCAAAACGCTCTCTCCACCATCCGATCTTCA
ATCCGAACCGCAATCAGCCGTGAACGTAGAATGGCTGCTTCTCTCATCCGTCTCCATTTCCACGACTGCTTCGTTAAT
GTATGTACTTAAAACATTTGATTCAACATGTGTGTGTGTGTC
CATACATATATGTGTTTTATGGACTGCTCTAAACTTTATATATTTTTTTTTTTTTTTTTTTAATTTGTAGGGTTGTGATGCATCGGTCATGCTCGTGGCAACTCCCACCATGGAGAGTGA
GAGAGATTCATTGGCAAATTTTCAATCGGCAAGAGGATTTGAAGTTATCGATCAAGCCAAATCAGCTGTAGAGAGTGTTTGTCCCGGCGTTGTTTCTTGCGCTGATATTATTGCCGTTGC
TGCTAGAGATGCTTCTGAATAT
GTTAGTCTCTATATCCATCTTTATATACATATATCTTGATTATTAATCCAAACATGTACATATTTATATATTCAACTACTACTTTAAACTTTTTCAAG
TAATATAATATTTACTTCTCTGACGTAAAATGTCATGTAAATGTTATAAGTTTACGGTTGCAAATTTGATTAATCATAGTTCTAATTAATTCTTGAATATGTAAATTTTGGTATCATCAA
TAGGTCGGAGGTCCAAGATATGATGTGAAGGTTGGTCGAAGAGATTCCACCAACGCGTTTAGGGCTATCGCAGACAGGGATCTCCCCAACTTCAGGGCTAGCCTCAACGATCTCTCTGAA
CTCTTCCTTCGAAAAGGACTCAACACAAGAGACCTCGTCGCTCTCTCAG
GTCAGTCACCCCGTAAAACACACTTTTGGTCACTAATTTCTTGCCATTTAAAACCTTTCTTGTGACACAAG
TTAACCCTATTTACAGGAGCTCACACATTAGGGCAAGCTCAATGCCTCACGTTCAAAGGTAGGCTTTACGATAACTCGAGTGACATTGACGCGGGATTCTCCAGTACCCGTAAGCGTCGT
TGTCCGGTCAACGGTGGAGATACGACTCTAGCACCTTTAGATCAAGTGACACCAAACTCGTTCGACAATAACTATTACAGAAACTTGATGCAGAAGAAAGGACTTTTAGAAAGCGATCAA
GTTTTGTTCGGAACCGGAGCTTCTACAGATAGTATAGTGACGGAGTACAGCAGAAATCCATCACGATTTGCGTCTGATTTCTCAGCTGCAATGATCAAAATGGGAGATATTCAGACACTC
ACTGGTTCAGATGGACAAATCCGAAGAATCTGCAGTGCCGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCTTCAAGATTCTTGTATTGTTGTTGAGTTTGTGTTGTTTCAGTCAAGCACAACTTTCTCCTACTTTCTACGACCAAACTTGTCAAAACGCTCTCTCCACCATCCGATCTTCA
ATCCGAACCGCAATCAGCCGTGAACGTAGAATGGCTGCTTCTCTCATCCGTCTCCATTTCCACGACTGCTTCGTTAAT
GGTTGTGATGCATCGGTCATGCTCGTGGCAACTCCCACCATG
GAGAGTGAGAGAGATTCATTGGCAAATTTTCAATCGGCAAGAGGATTTGAAGTTATCGATCAAGCCAAATCAGCTGTAGAGAGTGTTTGTCCCGGCGTTGTTTCTTGCGCTGATATTATT
GCCGTTGCTGCTAGAGATGCTTCTGAATAT
GTCGGAGGTCCAAGATATGATGTGAAGGTTGGTCGAAGAGATTCCACCAACGCGTTTAGGGCTATCGCAGACAGGGATCTCCCCAACTTC
AGGGCTAGCCTCAACGATCTCTCTGAACTCTTCCTTCGAAAAGGACTCAACACAAGAGACCTCGTCGCTCTCTCAG
GAGCTCACACATTAGGGCAAGCTCAATGCCTCACGTTCAAAGGT
AGGCTTTACGATAACTCGAGTGACATTGACGCGGGATTCTCCAGTACCCGTAAGCGTCGTTGTCCGGTCAACGGTGGAGATACGACTCTAGCACCTTTAGATCAAGTGACACCAAACTCG
TTCGACAATAACTATTACAGAAACTTGATGCAGAAGAAAGGACTTTTAGAAAGCGATCAAGTTTTGTTCGGAACCGGAGCTTCTACAGATAGTATAGTGACGGAGTACAGCAGAAATCCA
TCACGATTTGCGTCTGATTTCTCAGCTGCAATGATCAAAATGGGAGATATTCAGACACTCACTGGTTCAGATGGACAAATCCGAAGAATCTGCAGTGCCGTTAATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACATCAAGTT TCTTCAATTC ATTAAATCAC TTCTCAATTA GCTCTTACGA AATTCTTTTC ATTACTAAAA AAATTTACAA ACAAAAGTCT CTTGTAATAA GCTAAATGGC GATCTTCAAG  ATTCTTGTAT TGTTGTTGAG TTTGTGTTGT TTCAGTCAAG CACAACTTTC TCCTACTTTC TACGACCAAA CTTGTCAAAA CGCTCTCTCC ACCATCCGAT CTTCAATCCG AACCGCAATC  AGCCGTGAAC GTAGAATGGC TGCTTCTCTC ATCCGTCTCC ATTTCCACGA CTGCTTCGTT AATGGTTGTG ATGCATCGGT CATGCTCGTG GCAACTCCCA CCATGGAGAG TGAGAGAGAT  TCATTGGCAA ATTTTCAATC GGCAAGAGGA TTTGAAGTTA TCGATCAAGC CAAATCAGCT GTAGAGAGTG TTTGTCCCGG CGTTGTTTCT TGCGCTGATA TTATTGCCGT TGCTGCTAGA  GATGCTTCTG AATATGTCGG AGGTCCAAGA TATGATGTGA AGGTTGGTCG AAGAGATTCC ACCAACGCGT TTAGGGCTAT CGCAGACAGG GATCTCCCCA ACTTCAGGGC TAGCCTCAAC  GATCTCTCTG AACTCTTCCT TCGAAAAGGA CTCAACACAA GAGACCTCGT CGCTCTCTCA GGAGCTCACA CATTAGGGCA AGCTCAATGC CTCACGTTCA AAGGTAGGCT TTACGATAAC  TCGAGTGACA TTGACGCGGG ATTCTCCAGT ACCCGTAAGC GTCGTTGTCC GGTCAACGGT GGAGATACGA CTCTAGCACC TTTAGATCAA GTGACACCAA ACTCGTTCGA CAATAACTAT  TACAGAAACT TGATGCAGAA GAAAGGACTT TTAGAAAGCG ATCAAGTTTT GTTCGGAACC GGAGCTTCTA CAGATAGTAT AGTGACGGAG TACAGCAGAA ATCCATCACG ATTTGCGTCT  GATTTCTCAG CTGCAATGAT CAAAATGGGA GATATTCAGA CACTCACTGG TTCAGATGGA CAAATCCGAA GAATCTGCAG TGCCGTTAAT TAAAAGAGTT ATTACCTACT TGTCTTCAAC  GAGAAAAGTT CGAACCTTGA AAATTCATGT TATTATATTT ACGTGTATAC CCCATTTGAT TCATTTTTGT AATTGTGTGT AACTAAAATT CCTGCAGCGA TAATTCGTTT GTTATTTGAA 
TATATGGAAT AATAAATAT 

Retrieve as FASTA