Entry information : EgrPrx04 (Eucgr.A00042 / Egrandis_v1_0.018807m)
Entry ID 8016
Creation 2011-02-09 (Qiang Li)
Last sequence changes 2011-02-14 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-26 (Christophe Dunand)
Peroxidase information: EgrPrx04 (Eucgr.A00042 / Egrandis_v1_0.018807m)
Name (synonym) EgrPrx04 (Eucgr.A00042 / Egrandis_v1_0.018807m)
Class Class III peroxidase    [Orthogroup: Prx055]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx04
start..stop
S start..stop
EguPrx04 689 0 1..334 1..334
EcamPrx04 689 0 5..334 1..330
EgrPrx13 686 0 1..334 1..334
EcamPrx15 613 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 417784..418029 246 N° 2 417399..417584 186 N° 3 417105..417264 160 N° 4 416398..416810 413
complement(join(416398..416810,417105..417264,417399..417584,417784..418029))


exon

Literature and cross-references EgrPrx04 (Eucgr.A00042 / Egrandis_v1_0.018807m)
DNA ref. Phytozome 12:   scaffold_1 (418029..416398)
Protein sequence: EgrPrx04 (Eucgr.A00042 / Egrandis_v1_0.018807m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (312)
PWM (Da):   %s   37609.95 (35092.6)  
PI (pH):   %s   6.25 (5.68) Peptide Signal:   %s   cut: 23 range:23-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRASMWWQLLLSALALVSSCAAWRFEAEATIELPPPLQWHFYQNSCPDVERYVRDQVEFYWKQDSTLAVKLIQLLYTDCFIKGCDASILLDGPDTEKTAPQNAPILGFPLEVIDKVKEVLEQHCPGVVSCADIINLAARDAVVLAGGVSYPVPTGRRDGNSSSAKLVDIAVHATPWEKVIHYFEVRGMNVFDVTTLLGGHTLGRTRCKFIAERLYDFNNTGKPDQSMDPSFLAELRVQCPPNSTNSVYLNPDSGSSNRFGKTFYSRVLNHRAVLSIDQQIADREESLQIARRYDANFEDFLKMFGYAMTKLGNTWLLPGDQGEIRKNCRVVNRK*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Containing motif YTDC instead of FHDC.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAGCATCAATGTGGTGGCAGCTGTTGCTATCGGCGCTCGCGTTGGTGAGCTCGTGTGCGGCGTGGCGCTTTGAGGCCGAGGCGACGATCGAGCTGCCGCCGCCGCTGCAGTGGCAT
TTCTACCAGAACTCGTGCCCCGACGTCGAGAGGTATGTGAGGGACCAGGTCGAGTTCTACTGGAAGCAGGACAGCACCCTCGCGGTCAAGCTCATCCAACTTCTCTACACTGACTGCTTC
ATCAAG
GTACGTACCGTCTGCTCATTTCCCTCTCTCTCTCTCTCTCTCAAACGATCTCAAAGTCAGCATCGCTTCGATCATCGAGTTTCTGTCGCCCCTTCTGAGCATGCCATATACTTT
CACCCAATGGTTTAACCTCTCGGACTCGTCTTTCTAGCATACCAATCTTTTCTGAACATATGTATGGTTTATGTGGATAAAAAAGGGATGCGATGCGTCGATTCTCTTGGACGGGCCAGA
CACAGAGAAAACAGCACCACAAAATGCACCGATCCTAGGTTTTCCTCTTGAGGTGATTGACAAGGTCAAGGAAGTTCTGGAACAGCACTGTCCCGGGGTTGTCTCTTGCGCCGACATTAT
CAACCTTGCCGCTAGAGATGCTGTCGTCTTG
GTATGCAAAATGGTTCTCAGTTTTTCCTTTTTGGGCTGGAAAAGAGATATGCTGTTAGCTTGAGTTTTGGAGCGTTCGATATGGACAGA
AAAAAAAAAATCAGAATTCCTGATGTGATAATGATGCTGTAATAGGCGGGAGGAGTGTCGTACCCCGTTCCGACGGGGAGGAGGGACGGAAATTCGTCCAGTGCGAAGTTGGTGGACATC
GCAGTGCACGCCACCCCGTGGGAAAAGGTGATCCATTACTTCGAAGTAAGGGGCATGAATGTGTTCGACGTCACTACTCTACTTG
GTACGGTCTAACTCTCGAATGAAAAGTGTTTATTT
GACTCCGACCTCATTACATTACCTTAAGATCTTAACCAATTCAGGCAACTCATTTAATTCAGTGAATCAAGCTGTCCATTTAGCTTTCGCTAAGTCGAAGAATTTTATCAGATATAGAAT
CGTCGAGGATGTAATCCGAACCAATCCTCATAATGATCTCCCCCAAGTGCACAAAAATGGCATGCTCACGTAATATATCAATCTCTCAATCATAACCAATTCCTCCTTACTTTGCCAAAA
ACAATTTAAATTTTGCCAGGGGGCCATACACTGGGCAGGACTAGATGCAAGTTCATCGCAGAAAGACTGTATGATTTCAACAACACTGGCAAGCCAGACCAAAGCATGGACCCATCCTTC
TTGGCCGAATTGAGGGTGCAATGCCCGCCCAACTCAACGAATTCAGTGTACCTTAACCCTGACTCAGGCTCGAGTAACAGGTTCGGCAAAACCTTCTACTCCAGGGTCCTGAACCACCGG
GCCGTCCTCAGCATCGACCAGCAGATCGCCGACCGTGAGGAGAGCCTCCAGATTGCCCGGCGGTACGATGCCAATTTTGAGGACTTCCTGAAGATGTTCGGCTATGCTATGACCAAGCTG
GGGAACACCTGGCTCCTGCCAGGGGATCAGGGTGAGATTCGCAAGAATTGCCGAGTCGTGAACAGGAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAGCATCAATGTGGTGGCAGCTGTTGCTATCGGCGCTCGCGTTGGTGAGCTCGTGTGCGGCGTGGCGCTTTGAGGCCGAGGCGACGATCGAGCTGCCGCCGCCGCTGCAGTGGCAT
TTCTACCAGAACTCGTGCCCCGACGTCGAGAGGTATGTGAGGGACCAGGTCGAGTTCTACTGGAAGCAGGACAGCACCCTCGCGGTCAAGCTCATCCAACTTCTCTACACTGACTGCTTC
ATCAAG
GGATGCGATGCGTCGATTCTCTTGGACGGGCCAGACACAGAGAAAACAGCACCACAAAATGCACCGATCCTAGGTTTTCCTCTTGAGGTGATTGACAAGGTCAAGGAAGTTCTG
GAACAGCACTGTCCCGGGGTTGTCTCTTGCGCCGACATTATCAACCTTGCCGCTAGAGATGCTGTCGTCTTG
GCGGGAGGAGTGTCGTACCCCGTTCCGACGGGGAGGAGGGACGGAAAT
TCGTCCAGTGCGAAGTTGGTGGACATCGCAGTGCACGCCACCCCGTGGGAAAAGGTGATCCATTACTTCGAAGTAAGGGGCATGAATGTGTTCGACGTCACTACTCTACTTG
GGGGCCAT
ACACTGGGCAGGACTAGATGCAAGTTCATCGCAGAAAGACTGTATGATTTCAACAACACTGGCAAGCCAGACCAAAGCATGGACCCATCCTTCTTGGCCGAATTGAGGGTGCAATGCCCG
CCCAACTCAACGAATTCAGTGTACCTTAACCCTGACTCAGGCTCGAGTAACAGGTTCGGCAAAACCTTCTACTCCAGGGTCCTGAACCACCGGGCCGTCCTCAGCATCGACCAGCAGATC
GCCGACCGTGAGGAGAGCCTCCAGATTGCCCGGCGGTACGATGCCAATTTTGAGGACTTCCTGAAGATGTTCGGCTATGCTATGACCAAGCTGGGGAACACCTGGCTCCTGCCAGGGGAT
CAGGGTGAGATTCGCAAGAATTGCCGAGTCGTGAACAGGAAATAA

Retrieve as FASTA