Entry information : EgrPrx153 (Eucgr.J01618 / Egrandis_v1_0.043784m)
Entry ID 8017
Creation 2011-02-09 (Qiang Li)
Last sequence changes 2011-02-11 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-09 (Qiang Li)
Peroxidase information: EgrPrx153 (Eucgr.J01618 / Egrandis_v1_0.043784m)
Name (synonym) EgrPrx153 (Eucgr.J01618 / Egrandis_v1_0.043784m)
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx153
start..stop
S start..stop
EguPrx153 651 0 1..315 1..315
EglPrx153 647 0 1..315 1..315
EgrPrx154 647 0 1..315 1..315
EglPrx154 643 0 1..315 1..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21100468..21100647 180 N° 2 21100907..21101674 768  
join(21100468..21100647,21100907..21101674)


exon

Literature and cross-references EgrPrx153 (Eucgr.J01618 / Egrandis_v1_0.043784m)
DNA ref. Phytozome 11:   scaffold_10 (21100468..21101674)
Protein sequence: EgrPrx153 (Eucgr.J01618 / Egrandis_v1_0.043784m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316
PWM (Da):   %s   33836.8  
PI (pH):   %s   8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSFITFLNSGSATLQVGFYRSTCPSAESVVRKAVNKAVAKNPGIGAGLIRMHFHDCFVRGCDASILLDSTPGNPSEKEHPANNPSLRGFEVIDEAKAELESLCPQKVSCADILAFAARDSAYKLGSINYAVPAGRRDGLVSLKDEPSQNLPPFFFNAQQLEANFASKGLSLDEMVTLSGAHSIGVSHCSSFSDRLYSFNATHTQDPSMDTKLASQLKSKCPNNGGASDPTVPLDLVTPNRLDNKYYTNLKNHRGLLTSDQTLFNSPSTANIVRSNANNGGAWANKFAAAMVKMGSIDILTGNEGEIRRKCTVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (Egrandis_v1_0.043784m, scaffold_10, 21100468 - 21101665). Incorrect prediction from phytozome (Short 3' end and stop codon missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGCCCGTCTGCGGAGTCCGTCGTCCGGAAAGCTGTGAACAAAGCGGTGGCC
AAGAATCCCGGCATCGGTGCTGGGCTCATTAGAATGCATTTCCATGATTGCTTCGTTCGG
GTATGAATGGACTTTTTTGCACATTTCGGAAAATAGTAACTCGAGGAAAACCATTTTCTA
GCAAAAAGCGTACGCCTATTTTTCGTTGGTACAAAAGATATTGATGAGATGTGTGTGCGGAGTAAATTTCACATTCTATCACGAGTCCAGGACGTTTAAGTTTAGTCTAACTTGACGGCC
ACAAAATAATTATGTTTCTTATACAGATGCCCTTCAGCTATCCTTATAATTAATTGGCTGATCTTTGATCCAATAATAGGGTTGCGATGCTTCAATCTTGCTGGATTCGACCCCAGGCAA
CCCATCAGAGAAGGAACATCCCGCAAACAACCCGAGCTTGCGAGGTTTTGAAGTCATCGATGAGGCGAAGGCTGAGCTAGAGTCTCTATGCCCGCAGAAGGTCTCATGCGCTGACATTCT
TGCATTCGCAGCACGCGACAGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCGGGTCGCCGCGATGGGCTGGTCTCACTCAAAGACGAGCCCTCCCAGAATCTTCCTCCTTT
CTTCTTCAATGCGCAACAATTAGAAGCTAATTTTGCGAGCAAAGGCCTCTCTCTGGACGAGATGGTGACGCTATCCGGTGCACATTCGATTGGAGTCTCGCATTGCTCCTCCTTCTCGGA
CCGCTTGTACTCCTTCAATGCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTGGCTAGTCAACTGAAATCTAAGTGTCCGAACAATGGAGGCGCTAGCGATCCCACTGTGCCATT
GGACTTGGTCACGCCGAACAGGCTAGACAACAAGTACTACACTAATTTGAAGAACCACCGAGGCCTATTGACTTCTGATCAGACCCTTTTTAACAGCCCTTCGACGGCTAACATCGTGAG
GAGCAATGCAAATAATGGCGGAGCATGGGCAAACAAGTTCGCAGCAGCAATGGTGAAGATGGGATCGATCGACATCCTCACCGGGAACGAGGGTGAGATTAGGAGGAAATGCACGGTGGT
GAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGCCCGTCTGCGGAGTCCGTCGTCCGGAAAGCTGTGAACAAAGCGGTGGCC
AAGAATCCCGGCATCGGTGCTGGGCTCATTAGAATGCATTTCCATGATTGCTTCGTTCGG
GGTTGCGATGCTTCAATCTTGCTGGATTCGACCCCAGGCAACCCATCAGAGAAGGAACAT
CCCGCAAACAACCCGAGCTTGCGAGGTTTTGAAGTCATCGATGAGGCGAAGGCTGAGCTAGAGTCTCTATGCCCGCAGAAGGTCTCATGCGCTGACATTCTTGCATTCGCAGCACGCGAC
AGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCGGGTCGCCGCGATGGGCTGGTCTCACTCAAAGACGAGCCCTCCCAGAATCTTCCTCCTTTCTTCTTCAATGCGCAACAA
TTAGAAGCTAATTTTGCGAGCAAAGGCCTCTCTCTGGACGAGATGGTGACGCTATCCGGTGCACATTCGATTGGAGTCTCGCATTGCTCCTCCTTCTCGGACCGCTTGTACTCCTTCAAT
GCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTGGCTAGTCAACTGAAATCTAAGTGTCCGAACAATGGAGGCGCTAGCGATCCCACTGTGCCATTGGACTTGGTCACGCCGAAC
AGGCTAGACAACAAGTACTACACTAATTTGAAGAACCACCGAGGCCTATTGACTTCTGATCAGACCCTTTTTAACAGCCCTTCGACGGCTAACATCGTGAGGAGCAATGCAAATAATGGC
GGAGCATGGGCAAACAAGTTCGCAGCAGCAATGGTGAAGATGGGATCGATCGACATCCTCACCGGGAACGAGGGTGAGATTAGGAGGAAATGCACGGTGGTGAACTAG

Retrieve as FASTA