Entry information : ZmaAPx07 ( Zosma182g00510 [2.2])
Entry ID 8018
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2016-04-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-04-11 (Achraf Jemmat)
Peroxidase information: ZmaAPx07 ( Zosma182g00510 [2.2])
Name (synonym) ZmaAPx07 ( Zosma182g00510 [2.2])
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Zosteraceae Zostera
Organism Zostera marina    [TaxId: 29655 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmaAPx07
start..stop
S start..stop
CclAPx02 511 0 40..346 29..327
CsAPx05 510 0 40..346 27..325
GmAPx08 508 0 32..346 35..345
VuAPx03-2 508 0 41..346 42..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 322807..323109 303 N° 2 322589..322709 121 N° 3 322384..322484 101 N° 4 322149..322236 88
N° 5 321706..321773 68 N° 6 321519..321605 87 N° 7 320689..320763 75 N° 8 320512..320589 78
N° 9 320329..320433 105 N° 10 320190..320210 21  
complement(join(320190..320210,320329..320433,320512..320589,320689..320763,3215 19..321605,321706..321773,322149..322236,322384..322484,322589..322709,322807..3 23109))


exon

Literature and cross-references ZmaAPx07 ( Zosma182g00510 [2.2])
DNA ref. Phytozome 11:   scaffold_182 (323109..320190)
Cluster/Prediction ref. Phytozome Gene 11:   33180476
Protein sequence: ZmaAPx07 ( Zosma182g00510 [2.2])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349
PWM (Da):   %s   38287.34  
PI (pH):   %s   6.51
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKTLLFSSLVTSFSSFIHSESHPSLSPVSVKCTLSSSSLRTPQLFITRRTNEGLVPRLVSTSFSTRALSANFSASDPSQLKSANKDILELLKSTSCHPIFVRLGWHDSGTYDKNVEEWPLRGGANGSLRFEIELKHAANAGLVNALKLIQPIKDKYPNVTFADLFQLASATALDAGAPKIPMRYGRIDVTGPEQCPDEGKLPDAGPPSPAEHLRHVFYRMGLNDEIVALSGAHTLGRSRPERSGWGKPETKYTRDGPGAPGGQSWTVQWLKFDNSYFKDIKEKKDEDLLVLPTDAALFEDPSFKVYAEKYAEDQDAFFEDYSLAHAHLSDIGAKFDPPEGFCLSG*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAACACTCCTCTTCTCGTCTCTTGTCACATCCTTTTCTTCTTTCATTCACTCTGAATCGCATCCTTCTCTCTCGCCGGTGTCTGTGAAATGCACTCTTTCCTCCTCATCTCTT
CGCACTCCACAGCTCTTCATCACTAGGAGAACAAACGAGGGTTTGGTCCCAAGACTTGTCTCCACCTCCTTTTCTACTCGTGCTTTATCGGCCAACTTTTCAGCATCGGATCCCTCGCAG
TTGAAGAGTGCCAACAAGGACATCTTGGAGCTTCTTAAATCCACATCCTGCCACCCCATCTTC
GTGAGTTCACACACACCACTACGCTACTCCTATAATTCGATACAAATCATCGCCTTT
TTTTTTATATTTTTTTCTTTCATGGAAATTCATTGGAAAGGTTCGACTTGGATGGCATGATTCTGGAACGTACGATAAAAATGTGGAGGAATGGCCGTTGAGAGGAGGCGCTAATGGAAG
CTTGAGGTTTGAAATTGAGCTCAAACATGCCGCTAATGCTG
GTATTTCTGTGCAACTCTCTGCGTGTGTTCTTATTTTATCTGAAATCATTACAATTTTCATTTACTGTTTCGGTAATTA
TGGAATGGGACTGAGGTTTTTGCAGGTCTTGTAAATGCTTTGAAGCTTATTCAGCCAATCAAGGACAAATACCCCAATGTTACCTTTGCAGATTTATTCCAGCTAGCCAGTGCGACTGCC
CTTGAG
GTTTTTTGTTTTCTCAAGATTTTTAATCTCAATTTTGTTTTTTTATTGAATGTGAATTGAAATCTTAGAATTAGACTTGGCAGGTCGAGTAACTTAATATATGCTCATTTTTGC
TTTATTGTTCATCTTTTGCAATGCTACACTTAGGATGCTGGAGCTCCCAAAATTCCAATGAGATATGGTAGAATTGATGTTACTGGACCTGAGCAATGTCCAGATGAGGGGAAGCTTCCT
G
GTTAGATTTTTTTTTGCCAATGCAACTCTTTTATGTCATTTTCACTAGGGCTGCAGAAAACCCAACCCAAATATGTATTCATATTTACATATAATTCGATAAAAACAAAATAGATTTTT
GTTTTACTGGTTAAGCTTTATAATTTATTGGATTCAATTTCTAGCTACCTTAAAAACAATTTTTTTGAATCGATAAAAATCTCAAAATGCTAAACTCAGTTAAATGTTTCAATCTGATGT
TTTTAGCTCAAATTATCAGGTTAAATGTTTTGGAGATGCGATTCCTTTAATATATTCTAATCTACTTTATTTAGCTTCATGGAGCCATGTATATCTGATTATCTATCACGTACATATAAA
ATCTCCATTTCATTAGATGCCGGTCCACCTTCTCCTGCTGAACATCTACGCCATGTATTCTACAGAATGGGCCTTAATGACAAGGTATTTCTATTAAGTAATTAATTTTATGATTTGGTT
GTTTGGATGTCTTTCTTCCATTCTTATCAATAATAACCGATTAACCTCTACCGTTTGTTTTCAGGAAATAGTAGCACTTTCTGGTGCCCACACACTTGGCAGATCTCGACCTGAACGTAG
TGGATGGGGTAAACCAGAAACAAAGTACACG
GTAATAATATCTCACATTTTAATAATATTTTTATGTCTTATTAAGTGAATACGAAAAAGAATTAATGGTTAACTTGATTTCTATTTGCA
CATATCAGAGTTATTTACTTATTTTTCATACTTGGGGTCTGTAAGGATTATAACCCAGAGTAGATCGTAGAAGTGATCTTGTAAGAGTGTCTGAGTTATCAAGAAAAAGAAGAAGAAAAT
GATGAAGTGTTTGAACAAGGTTTTAACAAACCCCATATACTATTAAAAGTATAATCCAACTTAATAATTTGTTTACATACGATTTTGTATTTATAACTAGTAAACTAATATAGATTTACA
TAACTACACTTATAATAGATAGATAGTTATTACTAACTTGTTATTCTCACAGGGTCCATGTTAACTTGTTAAGTTTTTCATAATTTGCAATTTTGCATATATGATTGGTTTTAGAAACTT
GAAAATTTATCCTAATATTATTTCACATCAATAAGTTTTGACATCATACACAATATTATTCACTTTCAGCATAACTGCATAAGTTTTGTTAATTGCAACCATTTGTTGTTGTGGTGAAAG
ACTGAAAGCCTTCTTGTGTGGTCATGGTTAAAAAACTTGCGCTTAACTTATGTGTGATGCAACTGCAAGAATATCGATCAATGTATAAATTACATGTAGTATTAGTAGTATTAGTAGTAT
TATTGTATAGCCATGAATTGGACCTAGTATCATCAGTCACTAATGCATATTCTAATTTAATTGCAGAGAGATGGACCGGGGGCACCAGGAGGACAGTCATGGACAGTGCAATGGTTGAAG
TTTGACAACAGCTATTTCAAA
GTAAGTATTTTACCATTTACGATTTAATCAATACATAATGTACATCTCTGCCTCTGTTGATTTTAATGTATTTTCCCATTGATTGTGAATTATAATTAG

GATATCAAAGAGAAAAAGGATGAAGATCTATTAGTGTTGCCAACCGATGCGGCCCTTTTTGAGGATCCTTCATTCAAG
GTGGTTTTCACGTAGACGATGGATTTAAAATTTGTACACGTA
CACACAATTCTTTTATCTGATTATGTTTCTTTTTAGGTCTATGCTGAGAAATATGCAGAAGATCAGGATGCATTCTTTGAAGATTATTCATTGGCTCATGCTCACCTAAGTGATATTGGT
GCCAAATTTGACCCCCCTGAG
GTATGTGCGTGCCTAGTCTACTTAAGGAATATATACACTCTTTGTTATTTAATATTTTTTAATTTTTGAACACTAAATCACAGAGGACAATAATATATT
TGTCTTTAATTTTTTTCAGGGTTTCTGTCTTTCTGGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAAACACTCCTCTTCTCGTCTCTTGTCACATCCTTTTCTTCTTTCATTCACTCTGAATCGCATCCTTCTCTCTCGCCGGTGTCTGTGAAATGCACTCTTTCCTCCTCATCTCTT
CGCACTCCACAGCTCTTCATCACTAGGAGAACAAACGAGGGTTTGGTCCCAAGACTTGTCTCCACCTCCTTTTCTACTCGTGCTTTATCGGCCAACTTTTCAGCATCGGATCCCTCGCAG
TTGAAGAGTGCCAACAAGGACATCTTGGAGCTTCTTAAATCCACATCCTGCCACCCCATCTTC
GTTCGACTTGGATGGCATGATTCTGGAACGTACGATAAAAATGTGGAGGAATGGCCG
TTGAGAGGAGGCGCTAATGGAAGCTTGAGGTTTGAAATTGAGCTCAAACATGCCGCTAATGCTG
GTCTTGTAAATGCTTTGAAGCTTATTCAGCCAATCAAGGACAAATACCCCAATGTT
ACCTTTGCAGATTTATTCCAGCTAGCCAGTGCGACTGCCCTTGAG
GATGCTGGAGCTCCCAAAATTCCAATGAGATATGGTAGAATTGATGTTACTGGACCTGAGCAATGTCCAGATGAG
GGGAAGCTTCCTG
ATGCCGGTCCACCTTCTCCTGCTGAACATCTACGCCATGTATTCTACAGAATGGGCCTTAATGACAAGGAAATAGTAGCACTTTCTGGTGCCCACACACTTGGCAGA
TCTCGACCTGAACGTAGTGGATGGGGTAAACCAGAAACAAAGTACACG
AGAGATGGACCGGGGGCACCAGGAGGACAGTCATGGACAGTGCAATGGTTGAAGTTTGACAACAGCTATTTC
AAA
GATATCAAAGAGAAAAAGGATGAAGATCTATTAGTGTTGCCAACCGATGCGGCCCTTTTTGAGGATCCTTCATTCAAGGTCTATGCTGAGAAATATGCAGAAGATCAGGATGCATTC
TTTGAAGATTATTCATTGGCTCATGCTCACCTAAGTGATATTGGTGCCAAATTTGACCCCCCTGAG
GGTTTCTGTCTTTCTGGTTAG

Retrieve as FASTA