Entry information : EgrPrx91 ( Eucgr.F01472 / Egrandis_v1_0.046972m)
Entry ID 8022
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-15 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-13 (Christophe Dunand)
Peroxidase information: EgrPrx91 ( Eucgr.F01472 / Egrandis_v1_0.046972m)
Name (synonym) EgrPrx91 ( Eucgr.F01472 / Egrandis_v1_0.046972m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx91
start..stop
S start..stop
EcamPrx91 800 0 1..393 1..393
EglPrx91 800 0 1..393 1..393
EguPrx91 793 0 1..393 1..393
PpePrx50 479 2e-170 66..393 8..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..342 342 N° 2 436..633 198 N° 3 976..1141 166 N° 4 1247..1740 494
join(1..342,436..633,976..1141,1247..1740)


exon

Literature and cross-references EgrPrx91 ( Eucgr.F01472 / Egrandis_v1_0.046972m)
DNA ref. Phytozome 12:   scaffold_6 (18953311..18950840)
Cluster/Prediction ref. JGI gene:   104451628
Protein sequence: EgrPrx91 ( Eucgr.F01472 / Egrandis_v1_0.046972m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   403 (381)
PWM (Da):   %s   44287.9 (41887.6) Transmb domain:   %s   i5-22o
PI (pH):   %s   5.41 (5.41) Peptide Signal:   %s   cut: 22 range:22-402
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPNSLNGWIVIFVLLVSFLASFRNRKGSSADQRGRPFDPPFSLHPLSPVLLQRNDDGAAVDDEDPALGLQYDFYRNTCPAAEEIVRSSMSRIYSQHPDVAPAFLRLLFHDCFIRGCDASVLLDDSHGNRSHPIERQAIPNRTLKGFDRIDTIKQELEDHCPGVVSCADVLVLATREGILLAGGPFYPLFTGRRDSIQSYYADAMAEIPKPDDNVFRTLHLFGLRGFDERETVSLLGGHNIGKIGCEFILERLHNFLGTGQPDPTISADFLSEMRRNCGDSQTSSNSSSGSPLLMESTSLTKSDLGLTYFPQLATSISSGSSFDTHYYQSLLRGRGLLYADQQLMADERTASVVRAYASDDGSAFRLDFARAMMKMSSLGILSGSDGQIRKNCSSNLDQMVSV*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (a part of exon 1 is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAACTCCCTGAACGGCTGGATCGTCATCTTCGTCCTCCTCGTCTCCTTCCTCGCCTCCTTCAGGAACCGCAAGGGCTCGAGCGCCGACCAGCGTGGGCGGCCCTTCGACCCTCCC
TTCTCTCTCCACCCCCTCTCGCCCGTCCTTCTCCAGCGGAACGACGACGGCGCCGCCGTCGACGATGAAGACCCCGCGCTCGGGCTCCAGTACGACTTCTACCGCAACACCTGCCCTGCT
GCGGAAGAAATCGTGAGGTCTTCCATGTCCAGGATCTACTCCCAACACCCCGACGTCGCCCCCGCGTTTCTCCGTCTCCTCTTCCACGACTGCTTCATCAGG
GTTCCTCCTCCTCCTCCT
TCTTCGTCTCTGCTTTGTGGGGTTCCTCGTTTAGGGGCTGATTGCCATTGGGTTTGGGTTATTTTCTCGAGTCAGGGTTGCGATGCTTCAGTTCTCCTGGACGATAGCCATGGAAACCGC
AGCCACCCCATCGAAAGGCAGGCCATCCCCAACCGGACCCTCAAGGGTTTCGACAGGATCGATACCATCAAGCAGGAGCTTGAAGATCATTGCCCTGGGGTTGTTTCTTGTGCCGATGTT
CTCGTGCTCGCCACCCGGGAGGGCATCCTCCTG
GTACGCTCTTCTCTCGTTCCCCTCTTCCAATTTCAAGAAACTGTCCCGTCCCCTGTCATCGCCGTCCGTTCATGTGGATTTCGATGA
AATTTAGTATTCTCATATTGGCATTGAATTGGCGCTCTATGTGGAAAAGTTTAATAATGATTCTCGAAGTCAGCATGGCATTTGGGAAGATTTCATCTACTCCACGTCTAGGAACTTCTT
TCCTCTGTGTTTCCAGGCTTGCAGCTGGACGACAGCTACTTGATTAGTTTGTTCGAGCTTCTTAAGAATCTCTGTTTCTGTTTCCTTTTAACTCCTTATCCTATTCACCTCGTCTTTTGA
TGTTCGAGTCCACAGGCTGGTGGCCCATTCTATCCCCTTTTCACCGGCAGGAGAGACAGTATTCAGTCCTATTATGCAGATGCAATGGCTGAAATTCCTAAGCCCGACGATAATGTCTTC
CGGACGCTCCACCTGTTCGGTCTCAGAGGTTTTGACGAGAGAGAAACAGTCAGTCTCTTAG
GTATTATCACTAAAGTCCATCCTTCTATCTTACTTTGTGGTCGAGTTTGTTTGAACTGT
GAGTGGATAACCAGGCACTGAATTGATTAATTATGTTGATATGAAGGAGGTCACAATATCGGCAAGATCGGTTGTGAGTTCATCTTAGAACGCTTGCACAATTTCTTAGGGACAGGTCAG
CCAGACCCAACCATATCTGCAGATTTTCTTAGTGAGATGAGACGCAACTGTGGAGACAGTCAGACCAGCAGCAATAGCAGCAGTGGCTCTCCACTGCTCATGGAATCAACGAGCCTTACT
AAGTCTGATTTGGGTTTGACATACTTCCCACAGTTAGCGACTTCAATTTCTTCCGGATCAAGCTTTGACACCCATTATTACCAGAGCTTGCTTAGAGGGAGAGGTCTTCTATATGCTGAT
CAGCAGTTAATGGCTGACGAGAGAACTGCAAGTGTCGTAAGGGCTTATGCCTCAGATGACGGATCAGCCTTCAGATTGGACTTTGCTCGTGCTATGATGAAAATGTCAAGTCTTGGTATA
TTGTCTGGATCAGATGGGCAGATCCGAAAAAATTGCTCGTTTGTCGCCAACGGCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAACTCCCTGAACGGCTGGATCGTCATCTTCGTCCTCCTCGTCTCCTTCCTCGCCTCCTTCAGGAACCGCAAGGGCTCGAGCGCCGACCAGCGTGGGCGGCCCTTCGACCCTCCC
TTCTCTCTCCACCCCCTCTCGCCCGTCCTTCTCCAGCGGAACGACGACGGCGCCGCCGTCGACGATGAAGACCCCGCGCTCGGGCTCCAGTACGACTTCTACCGCAACACCTGCCCTGCT
GCGGAAGAAATCGTGAGGTCTTCCATGTCCAGGATCTACTCCCAACACCCCGACGTCGCCCCCGCGTTTCTCCGTCTCCTCTTCCACGACTGCTTCATCAGG
GGTTGCGATGCTTCAGTT
CTCCTGGACGATAGCCATGGAAACCGCAGCCACCCCATCGAAAGGCAGGCCATCCCCAACCGGACCCTCAAGGGTTTCGACAGGATCGATACCATCAAGCAGGAGCTTGAAGATCATTGC
CCTGGGGTTGTTTCTTGTGCCGATGTTCTCGTGCTCGCCACCCGGGAGGGCATCCTCCTG
GCTGGTGGCCCATTCTATCCCCTTTTCACCGGCAGGAGAGACAGTATTCAGTCCTATTAT
GCAGATGCAATGGCTGAAATTCCTAAGCCCGACGATAATGTCTTCCGGACGCTCCACCTGTTCGGTCTCAGAGGTTTTGACGAGAGAGAAACAGTCAGTCTCTTAG
GAGGTCACAATATC
GGCAAGATCGGTTGTGAGTTCATCTTAGAACGCTTGCACAATTTCTTAGGGACAGGTCAGCCAGACCCAACCATATCTGCAGATTTTCTTAGTGAGATGAGACGCAACTGTGGAGACAGT
CAGACCAGCAGCAATAGCAGCAGTGGCTCTCCACTGCTCATGGAATCAACGAGCCTTACTAAGTCTGATTTGGGTTTGACATACTTCCCACAGTTAGCGACTTCAATTTCTTCCGGATCA
AGCTTTGACACCCATTATTACCAGAGCTTGCTTAGAGGGAGAGGTCTTCTATATGCTGATCAGCAGTTAATGGCTGACGAGAGAACTGCAAGTGTCGTAAGGGCTTATGCCTCAGATGAC
GGATCAGCCTTCAGATTGGACTTTGCTCGTGCTATGATGAAAATGTCAAGTCTTGGTATATTGTCTGGATCAGATGGGCAGATCCGAAAAAATTGCTCGTTTGTCGCCAACGGCAATTGA

Retrieve as FASTA