Entry information : EgrAPx08 (Eucgr.F04344 / Egrandis_v1_0.012544m)
Entry ID 8023
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrAPx08 (Eucgr.F04344 / Egrandis_v1_0.012544m)
Name (synonym) EgrAPx08 (Eucgr.F04344 / Egrandis_v1_0.012544m)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrAPx08
start..stop
S start..stop
EguAPx08 852 0 1..446 1..446
EglAPx08 844 0 1..446 1..446
EcamAPx08 717 0 95..446 1..352
GmAPx07 658 0 17..446 10..432
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 52379874..52380122 249 N° 2 52380468..52380611 144 N° 3 52381090..52381210 121 N° 4 52381284..52381384 101
N° 5 52381495..52381582 88 N° 6 52382258..52382325 68 N° 7 52382412..52382498 87 N° 8 52383702..52383776 75
N° 9 52383864..52383941 78 N° 10 52384027..52384131 105 N° 11 52384639..52384710 72 N° 12 52384997..52385149 153
join(52379874..52380122,52380468..52380611,52381090..52381210,52381284..52381384 ,52381495..52381582,52382258..52382325,52382412..52382498,52383702..52383776,523 83864..52383941,52384027..52384131,52384639..52384710,52384997..52385149)


exon

Literature and cross-references EgrAPx08 (Eucgr.F04344 / Egrandis_v1_0.012544m)
DNA ref. Phytozome 11:   scaffold_6 (52379874..52385149)
Protein sequence: EgrAPx08 (Eucgr.F04344 / Egrandis_v1_0.012544m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   447
PWM (Da):   %s   48195.85 Transmb domain:   %s   o426-445i
PI (pH):   %s   8.82
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQLLPLQPQSFSSSPPPSASTATAPMASLTGAAAASRLLPSASRARLSLSLSSSAGRSPASPLSSLRCLRGSSPLASRLFLSQRRPSMHLLAAQYSGAASPKCAASDPEQLKGAREEIKELLKTKFCHPLLVRLGWHDAGTYNKNIEEWPKRGGANGSLRCEIELKHAANAGLVNALKLIEPIKEKYPSVTYADLFQLAGATAIEAGGPKIPMKYGRVDVSKPEECPEEGRLPDAGPPSPANHLREVFYRMGLNDEIVALSGAHTLGRSRPERSGWGKPETKYTKDGPGAPGGQSWTVQWLKFDNSYFKDIKERKDEDLLVLPTDGVLFEDPSFKVYAEKYAEDQEAFFKDYAEAHAKLSNLGAKFDPPEGIVIDGPAKAAPEKFVAATYSSGKRELSDAMKQKIRAEYEGFGGSPDKPLQSNYFLNIIIVIAALALLSSLVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Alternative transcript predicted from Phytozome (Egrandis_v1_0.015028m. last exon is missing). Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAACTCCTCCCCCTCCAACCGCAGTCCTTCTCCTCGTCACCGCCACCATCCGCGTCGACAGCAACGGCGCCCATGGCTTCTCTCACCGGCGCCGCCGCCGCCTCCCGCCTCCTCCCC
TCCGCCTCCCGCGCCCGCCTCTCCCTCTCCCTCTCCTCCTCCGCCGGCCGCTCCCCTGCTTCTCCTCTCTCCTCTCTCCGATGCCTCCGCGGATCGTCCCCGCTCGCTTCTCGCCTCTTC
CTCAGCCAG
GTACGCCCGCGCTTGCTTCCTTTCTTTCCTCCAATCTCGCGTCTCGCGTCTTCCTCGGCCAGCTCGAGTTTAGGATTGGGCGTTCCTCTCTCAGTGGAGCATTCGCGTGTG
GTGATCGTGCGTCGCTTTGCTTTGCTCTCGCTGTTTTGCTCCGATTAGCTGCGTTTCGGTTCGGTCTCTCTCTGAGTGCGTCTGTCCGGACGTAGCTCTGCTTAAGTCGTCTACGTTGGA
TAAGCGCGTGTGGATCGTGTACATTCCGGTCCTGTTCCCTTGTTGCTGTTTCGATTCCGTCGCCTCGTACTGCTTCCGTAGTGGTTTTCGGCTTGACTCGTGATGAAAATGCAGAGGAGG
CCGTCCATGCACCTGTTGGCCGCGCAGTACAGCGGAGCCGCGTCTCCTAAATGCGCCGCGTCCGATCCGGAGCAGCTGAAGGGCGCCAGGGAAGAAATTAAGGAGCTTCTCAAGACTAAG
TTCTGTCATCCTCTTCTG
GTAACGTGCCTTCGTATCCTCTGCAAAATGATTAGTTCTTATTCTGCCTGTTTGTGTCGTTTGTTTGAATTAGCCGGCTCTGATTTTCAGTGATTTTGGAAG
ATATATACTTTAATCGCGGCACGAGATGATGCTGAATGAACGAAATTGCTCTTGCTATTGTAATGTGTTTAGCCTACTGCACAGATTCATCTATCCCCTGAAGAAAGCATATCTATTTTT
GGAATGAACCCTTAGTTGAGAAAATACACCTCTGAGATGCTATGGATAATTTAAGCACCTGAGATTTTGAAACTTCATTACATTGTTCCCATCCATTTAGCTAGCTGACAACAGAGAACT
GTAAATCCTGAAGTGGCTAATCACCATGTTCCCACTCGTCTATGCAATCTACTAGGTCTGACAGTCTCTGCATTACATGTGTTTTGTAGGAAAAGGAAATAGAATTTGCCGTTAATGACA
TATGAGTACTTTACAGGTTCGGTTGGGATGGCATGATGCTGGTACTTATAATAAGAACATCGAAGAATGGCCTAAAAGAGGTGGAGCTAACGGGAGTCTTCGGTGTGAAATTGAGCTTAA
GCATGCAGCTAATGCTG
GTAATAATTTAGCAGTGATACTACGGGTGGCATGACTTGTTTCTTGAACTTCTCTCAAAACTAGCTTTTACAGGTCTTGTAAATGCACTAAAACTTATTGAGC
CAATCAAAGAAAAATATCCCAGTGTGACATATGCAGACTTGTTTCAGCTGGCTGGCGCTACTGCTATCGAG
GTCAGTTTTTGCGCTCTTAATTGCTTAACCTGAGATTTCTTGAAGCCAT
ATGTAACCTGAGATTCACTCGTTCTTTGTGAAAATGTTCTTCCTTTTACTTTATTCTTCAGGAAGCTGGTGGTCCCAAGATTCCCATGAAGTATGGAAGAGTTGATGTCTCAAAACCTGA
GGAGTGCCCTGAAGAAGGGAGGCTTCCTG
GTGAGTGAAACATTGTTGTTCATTAAAGAGTAGACATCCACTCGGCTTTGTTGTACTAGGGGATCACTAATTTGGCTCTATGAAGCACTGT
AACTATCTCGCGCAAGTTGTTGCGATGTGCCGATTATTCGACTTCTTTTTCTATGATAAATCTGAGTGGGCACCCTAACACGCAAAGGCTTCTTTTTTAGGTGAGATTTGTACTTAAGGT
TGAAGGTGGTAATTTTAAAGAACTGTAATTTGCTGATTTGGGCAACAGATGAAGTTCTAGATGACTTGATTCATTTAGGCATTTACTAAAAAAATTCAAGCAACAAGAGATGTATTCATC
CTAGGTCTGTGTTTTGTTTCTGAATGGATCACATTCGTATGCGTGGTAAGCTCTTGAAACAAAGCATTGTTTGGAAAAAAAAAGAATATGCATTTAGATGCGCTTTATCACACATAAATG
AACTTGAATATCCCGTCCTTTCTATGGTCAGAAGTCATTTTCTATCTCTCGTCTGGAGTTTTCACTTTTTTATTCTGTCTCCAGTGATTGATTTCTTCTCTTTCTCGGATCCTTTTGTCT
CACTTATTAGTGTACTTTCTACTTCTGCCAGAAAAAAAGTTTTTGTCGGTTCCTCTTGGAACAATCCATTTCTTCTCTTTTTACTGAACAGTTCTTTCTTTCAGATGCTGGCCCCCCTTC
ACCAGCCAATCATCTCCGGGAAGTTTTCTACAGGATGGGACTAAATGACAAG
GTTTTTGTAATCGTTACCTAATGGGATGTTGTGTGCTATTTGTGTGTATCTCATGTGCTTGAGACTAT
GAATTCTCTGTTCTGCAGGAAATAGTTGCTTTATCTGGGGCACACACTCTTGGAAGGTCAAGACCAGAACGTAGTGGGTGGGGCAAGCCAGAAACAAAGTACACGGTAACTAATTACTTT
CTATTTATTAATGTAATGCTCCGTACTAATCATTTGACAAACTCAACTTGCCATAGGAATTCTGAAACAGCATGCATAGTGTCGAGAATGTATTTTCCATGGTTACCATTGGTGAATTGA
AAGTTATCCTCGATATACAATTAGAGTTATGAACTCTTGAGCATCTTTAAACGAATAACAGGGAACAGGACTCTGATGGTCATAGTCTTGTCCATTAAACGTGAAAAACTACAGAAATGT
TATGTTTGGATTTAGAAACAATATTTCATTGAGCTCCAAGCACTTAAGGAGCTGTGCAGTAGGATGGCGTTCTATCAGTGATCAACCATCAGAAATAGATTGATATTCCCAAGGACGTTG
TTGTAAATTCTTTTATGTGCTTGTAATCTCCATTGTCTCACACAGTTGCGACTCATGATTTGGGTTACAATATTTTGGCTTGATGGTCACGATGATGCCCAGAAAAGGTAGCCATTTATA
GTGTGGCTTGTGACCACGTTAATGAATCTCAATAGCCATATTTGTTGCCATGGGATTTGCGCCTCAGAGTCTCTTTTGTTAAGGATGACAGTTGTCTATTAATTTCCATAGAGGAGGTCC
ATATCAACTGATATTTGCAGATCTTTTCTTCTAGGAGTACAAGAAGCAAGCATTTTAGGGGTTAGTTGGTCAGCTTAAAGAGTTTGTTTACATCATTACCGTCTGTGTAGTATCAAATCC
TCTATAAAACTCAAGAACTCGGCATCTTTCTAAAAAGTATCCATCCATGTCTTTTAGGTCTTATTTACCTCTTTTACATGTGTCCATTGTAATGTCACATCTTCTTACTTTATCATCTGT
AGGCCATTGCCTTTTGTGTCCAAACTACTTTAGAAAGGTTTTTCATCTTATTCCCACTTTAAGCCACCCCCTCAGCTATGATCTGTTCTAACTTGATCTTGTGTTAGTGTCCAAATATCC
TTAGGCATTATTATCTTAGCTATATTAGTTTTGTACGTGTGCCTTTCTTACCGACAGTAGAAATGGTTGTGGACATTGAAGCTTGGGAAAAGTTTCTCCCCAGTGGACAAATTAATGGCT
GCTTGAATTGAACTTATATGACTATTTTCAACAATATAGTTTAGTTGAAATGATTAAGAATAGTATAAATGGCCTTCATGAATCGTAATGGCCTCCATCATGTCACAGAAAGATGGACCA
GGAGCACCAGGTGGACAGTCGTGGACCGTGCAATGGTTAAAGTTTGATAACTCATACTTCAAG
GTTTGCGAGTTGAATCCATACGTACTTTTTCCATGGGAAGGTGGTGATTCAGAATCA
AGTGGGATGCTAACTTGATGTTTCATGCAGGATATAAAAGAACGGAAGGATGAAGACCTGCTGGTATTGCCAACTGATGGTGTTCTTTTTGAAGATCCTTCATTCAAGGTAATAAGAGTT
TTTCTGAAAGCTCCAAAACAAAAGAAGTCTCTAAATTTGAGTTATCTTTCTAAAGAATGTTAGCGAATTGTAGGTCTATGCTGAGAAATACGCTGAAGATCAGGAAGCATTCTTTAAGGA
TTATGCTGAAGCACATGCAAAACTCAGCAACCTTGGTGCAAAATTTGATCCTCCAGAG
GTTTGTCACTGCTCTCTTATGGTCATTCCTTTGCTAATTGTAGTGACGCTGGACCGTGTTCG
AATCATTTCCAATGCCTTCTTAATTTTAAGTTTTTAAGGAGCCAATGGCCAAAGTTCTATAAGAACTGTCCGAATATTTGAAATTCTTCCATGACGTTCATGTTGGCTATTTGACCATCT
GTTGTGATGGCATTGGCCTCTGGATCAAGTGAAATTTGCAGGATTGATGGGGCCTCCCATTTGGAGACGCATCAATTGTAGTTTTATTGCCAAATATTGCACGGCATGAATAACCATCAA
GTTCATCTTATCAGCATTGATGTTTGGCTTGTTATGAAAAATTTGTGCGTAGATAACAAGCGCTTCTACCTATTTACAAATTTTTCTTGGGTCTAGATTTACAAGTTTTTCTTCAGTCTA
GATTTACTAGTTTGCAATTTAACTTATACAGAACTTGGGTTAGAGTTGTGGTGAAAACTAAAGCTTATGTTGAGTAATCTTTCAGGGTATCGTGATAGATGGTCCTGCTAAAGCTGCACC
GGAGAAGTTTGTGGCTGCCACCTACTCATCTGGAAAG
GTTATACTAAGAAATAACTTACATCTTGATCTTCCATTGTTACAGAGAGTTCCTTTTCATTATGTGATCTTTAACGGAGAGAC
TATTTCTTTGCAAATTGTTCATGTTCCTTGTTTCTTATGGTTTGCTGCAGGATTAGAAAACAATGTCCCGTTTTCTGTGCCGTGTCTTTTATAAATAAAAGATGGAAGATATTTTCAATC
TTGTGAAACCACTTCTTAAAACTTGGGGAGTCTTAGCGAAAGGAGGAATAAAATTCAACGCGTGTTGCGTATTTGAATTGCAGAGAGAACTGTCAGATGCTATGAAGCAGAAGATCCGAG
CTGAGTATGAAGGATTCGGTGGCAGCCCAGATAAGCCCCTGCAATCCAACTATTTTCTGAACATAATCATTGTCATTGCTGCTTTGGCACTCTTGTCATCTCTAGTAGTAAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAACTCCTCCCCCTCCAACCGCAGTCCTTCTCCTCGTCACCGCCACCATCCGCGTCGACAGCAACGGCGCCCATGGCTTCTCTCACCGGCGCCGCCGCCGCCTCCCGCCTCCTCCCC
TCCGCCTCCCGCGCCCGCCTCTCCCTCTCCCTCTCCTCCTCCGCCGGCCGCTCCCCTGCTTCTCCTCTCTCCTCTCTCCGATGCCTCCGCGGATCGTCCCCGCTCGCTTCTCGCCTCTTC
CTCAGCCAG
AGGAGGCCGTCCATGCACCTGTTGGCCGCGCAGTACAGCGGAGCCGCGTCTCCTAAATGCGCCGCGTCCGATCCGGAGCAGCTGAAGGGCGCCAGGGAAGAAATTAAGGAG
CTTCTCAAGACTAAGTTCTGTCATCCTCTTCTG
GTTCGGTTGGGATGGCATGATGCTGGTACTTATAATAAGAACATCGAAGAATGGCCTAAAAGAGGTGGAGCTAACGGGAGTCTTCGG
TGTGAAATTGAGCTTAAGCATGCAGCTAATGCTG
GTCTTGTAAATGCACTAAAACTTATTGAGCCAATCAAAGAAAAATATCCCAGTGTGACATATGCAGACTTGTTTCAGCTGGCTGGC
GCTACTGCTATCGAG
GAAGCTGGTGGTCCCAAGATTCCCATGAAGTATGGAAGAGTTGATGTCTCAAAACCTGAGGAGTGCCCTGAAGAAGGGAGGCTTCCTGATGCTGGCCCCCCTTCA
CCAGCCAATCATCTCCGGGAAGTTTTCTACAGGATGGGACTAAATGACAAG
GAAATAGTTGCTTTATCTGGGGCACACACTCTTGGAAGGTCAAGACCAGAACGTAGTGGGTGGGGCAAG
CCAGAAACAAAGTACACG
AAAGATGGACCAGGAGCACCAGGTGGACAGTCGTGGACCGTGCAATGGTTAAAGTTTGATAACTCATACTTCAAGGATATAAAAGAACGGAAGGATGAAGAC
CTGCTGGTATTGCCAACTGATGGTGTTCTTTTTGAAGATCCTTCATTCAAG
GTCTATGCTGAGAAATACGCTGAAGATCAGGAAGCATTCTTTAAGGATTATGCTGAAGCACATGCAAAA
CTCAGCAACCTTGGTGCAAAATTTGATCCTCCAGAG
GGTATCGTGATAGATGGTCCTGCTAAAGCTGCACCGGAGAAGTTTGTGGCTGCCACCTACTCATCTGGAAAGAGAGAACTGTCA
GATGCTATGAAGCAGAAGATCCGAGCTGAGTATGAAGGATTCGGTGGCAGCCCAGATAAGCCCCTGCAATCCAACTATTTTCTGAACATAATCATTGTCATTGCTGCTTTGGCACTCTTG
TCATCTCTAGTAGTAAATTGA

Retrieve as FASTA