Entry information : EgrPrx98 ( Eucgr.F04267 / Egrandis_v1_0.017859m)
Entry ID 8026
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-05 (Christophe Dunand)
Peroxidase information: EgrPrx98 ( Eucgr.F04267 / Egrandis_v1_0.017859m)
Name (synonym) EgrPrx98 ( Eucgr.F04267 / Egrandis_v1_0.017859m)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx98
start..stop
S start..stop
EguPrx98 707 0 1..349 1..349
EglPrx98 706 0 1..349 1..349
EcamPrx98 650 0 1..349 1..341
GhPrx05 425 3e-150 40..349 17..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 50899714..50899986 273 N° 2 50900732..50900914 183 N° 3 50901075..50901237 163 N° 4 50901550..50901980 431
join(50899714..50899986,50900732..50900914,50901075..50901237,50901550..50901980 )


exon

Literature and cross-references EgrPrx98 ( Eucgr.F04267 / Egrandis_v1_0.017859m)
DNA ref. Phytozome 12:   scaffold_6 (50899714..50901980)
Protein sequence: EgrPrx98 ( Eucgr.F04267 / Egrandis_v1_0.017859m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350
PWM (Da):   %s   37910.37 Transmb domain:   %s   i12-34o
PI (pH):   %s   8.4
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLIMLRTKRRSSSSNVVATAIIAVLVLLVMHVMGSSESEGQEQQQLRVGFYSKSCPPAESIVHAVVKEAVLSVPRNAAVLLRIHFHDCFVEGCDGSILIDNGDISERHAGAHAGVGGFEIIEAAKARLESTCPGVVSCSDIVAMAARDAVFLSNGLFYEVQTGRRDGRVSNWTLAADMPDVNDSIHMLKAKFRQKGLKDKDLVLLSAAHTIGTTACFFMGTRLYQFNSTGGSDPAINPRFLPVLKSICPPGGDVNVRLALDAATEFVFDDLILHNIKNGFAVISSDARLYDSRHTRRIVDLYTQNGTSYKHEKPPSFKVDFAASMVKMGRIGVKTGSQGEIRRVCSSFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_6, Egrandis_v1_0.012544m). It is similar to sequence Egrprx38 (scaffold_241, Egrandis_v1_0.053641m).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGATAATGCTGAGGACGAAGAGAAGGTCCAGCTCCAGCAATGTCGTCGCGACGGCCATTATCGCAGTTCTCGTCCTCCTCGTCATGCATGTTATGGGCTCGTCGGAATCGGAAGGA
CAAGAGCAGCAACAGCTTCGAGTCGGGTTTTACTCCAAAAGCTGTCCACCGGCTGAGTCCATCGTCCACGCCGTCGTCAAAGAGGCGGTCCTCTCGGTCCCTCGGAACGCCGCCGTCTTG
CTTCGGATTCATTTCCACGACTGCTTCGTTGAG
GTGAATGATTTTGCCTTTTCCGCTTCCCTGAATAAACGTCTGTCTCTTTGCAATCAATGCGTCTTCATACACGACAGTTTTTAAATT
ATTAAATCGTGAGAAAAGTTTTTCAGTAAATGTTCATAATCTAGTACTTGTTAATTAACTTTCCTTACTGAAGAAGCAGGAAAATGCGGTCGAATTGTTGCTTTGGTAGACTAGTCTCAC
TAAAATGTCAAGATAACATCGTACAAATGATAAAACCAGAGCAAGGATATTTACACACAAAGGTGTTATGGTTTGTCGTGTAATTGATGGTGTTACATCTTGTACAATAAATTTCGTGGC
AAATAGTACCAAATGATCTAGTAAATATTTTTTACAGTTCCATCATGCGTGATCTTTGGTAAATAACCACCGATAGAAACCCTTGAAGTTACCCACTTTAATGGCTTCGGTGCATGATTT
TTGGGGATCGGGGATCGCTTTTGTGATATGCAAGGAGACAACATCATGGTCTGCTGAATAATTAAAAGGGCGGCACTGGAATTTCGTGGGACGACCTTCATTATTTTGGCTTGAGAACAG
CAAATGATCGGTCATAAGAAGGGACTAAATCGACCTTGAAAATCTTTTTTCCGTCAATGATTTTATCAGTGTTATTGCTCCTTCTCCACAGACCCAATAGGCAGTAATTTGTGCTGACGT
GGTAATTAATTTACACTAATTGTTGAGCAGTTTCTGATGACATATACATGTTAAACAGGGATGCGACGGGTCGATCCTGATCGACAATGGGGATATCAGCGAGCGGCACGCAGGGGCACA
TGCGGGTGTCGGAGGCTTTGAGATAATTGAAGCGGCCAAAGCTCGCTTGGAAAGCACTTGTCCTGGGGTCGTCTCTTGCTCCGATATCGTAGCTATGGCTGCTAGAGATGCTGTTTTCTT
G
GTACATACTTTCCCCATCTTATACTCTTGCTGGCACAGATTTTGCTATCCAAATACCATTTGATAGCTCTTTCCTTTAGAAGGAAAGTAAAAAGGGAGAGAAAGGTGTCAATTTTGATT
GCTCTGGTGGATTGAAGTTGTGTTGGCTTCATATGGTGCAGAGCAATGGCCTGTTCTATGAGGTGCAGACGGGGAGAAGAGACGGCCGCGTCTCAAACTGGACGCTCGCTGCAGATATGC
CGGATGTGAATGACTCGATTCATATGCTCAAGGCCAAGTTTAGACAGAAGGGGCTTAAAGATAAAGACCTCGTTCTTCTCTCCG
GTACGCCGCTCTTTACTAGTCAGCAGATATGATTTA
TCAGCACAGCCGATTAATTACTCGGACAATACGTTAATATAGTCTAATGTCTTAACAATTAGTAACATGACCATGTCAAGAAGAAGCAGGAATTTCCTCCTGAAACAACTACTCTTGCCT
TTAAGCTCCCCAAATGCATGTTCTAGAGCAGGAATTTGCTTCTGAAACAACTACTCTTGCCTTTTAGCTCCTCAGATGCATTTCTTTTTTCATCATTTGATATTCTAGAGCAGGAATTTC
CTTCTGAAACAACTACTCTTGGCTCTCCGTTTCTAGCTGCGCATACCATCGGAACAACCGCGTGTTTCTTCATGGGCACGCGGCTCTACCAATTCAATTCCACAGGCGGGTCAGACCCTG
CGATTAACCCTCGCTTCCTTCCGGTTCTCAAGTCCATATGCCCCCCCGGTGGGGATGTCAACGTGAGATTGGCTCTGGATGCCGCCACTGAGTTCGTGTTCGATGATCTGATACTTCACA
ACATCAAGAACGGATTTGCCGTGATATCTTCGGACGCGAGGCTCTATGACAGCAGACACACCAGGCGGATAGTTGATCTGTATACTCAGAATGGGACTTCTTATAAGCACGAAAAACCAC
CGTCCTTCAAGGTGGATTTTGCAGCTTCGATGGTGAAGATGGGTCGGATTGGCGTGAAGACGGGTTCCCAAGGAGAGATTAGGAGAGTTTGCAGCTCTTTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGATAATGCTGAGGACGAAGAGAAGGTCCAGCTCCAGCAATGTCGTCGCGACGGCCATTATCGCAGTTCTCGTCCTCCTCGTCATGCATGTTATGGGCTCGTCGGAATCGGAAGGA
CAAGAGCAGCAACAGCTTCGAGTCGGGTTTTACTCCAAAAGCTGTCCACCGGCTGAGTCCATCGTCCACGCCGTCGTCAAAGAGGCGGTCCTCTCGGTCCCTCGGAACGCCGCCGTCTTG
CTTCGGATTCATTTCCACGACTGCTTCGTTGAG
GGATGCGACGGGTCGATCCTGATCGACAATGGGGATATCAGCGAGCGGCACGCAGGGGCACATGCGGGTGTCGGAGGCTTTGAGATA
ATTGAAGCGGCCAAAGCTCGCTTGGAAAGCACTTGTCCTGGGGTCGTCTCTTGCTCCGATATCGTAGCTATGGCTGCTAGAGATGCTGTTTTCTTG
AGCAATGGCCTGTTCTATGAGGTG
CAGACGGGGAGAAGAGACGGCCGCGTCTCAAACTGGACGCTCGCTGCAGATATGCCGGATGTGAATGACTCGATTCATATGCTCAAGGCCAAGTTTAGACAGAAGGGGCTTAAAGATAAA
GACCTCGTTCTTCTCTCCG
CTGCGCATACCATCGGAACAACCGCGTGTTTCTTCATGGGCACGCGGCTCTACCAATTCAATTCCACAGGCGGGTCAGACCCTGCGATTAACCCTCGCTTC
CTTCCGGTTCTCAAGTCCATATGCCCCCCCGGTGGGGATGTCAACGTGAGATTGGCTCTGGATGCCGCCACTGAGTTCGTGTTCGATGATCTGATACTTCACAACATCAAGAACGGATTT
GCCGTGATATCTTCGGACGCGAGGCTCTATGACAGCAGACACACCAGGCGGATAGTTGATCTGTATACTCAGAATGGGACTTCTTATAAGCACGAAAAACCACCGTCCTTCAAGGTGGAT
TTTGCAGCTTCGATGGTGAAGATGGGTCGGATTGGCGTGAAGACGGGTTCCCAAGGAGAGATTAGGAGAGTTTGCAGCTCTTTCAATTAA

Retrieve as FASTA