Entry information : EgrPrx75 (Eucgr.D01322 / Egrandis_v1_0.018909m)
Entry ID 8033
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx75 (Eucgr.D01322 / Egrandis_v1_0.018909m)
Name (synonym) EgrPrx75 (Eucgr.D01322 / Egrandis_v1_0.018909m)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx75
start..stop
S start..stop
EguPrx75 685 0 1..333 1..333
EglPrx75 685 0 1..333 1..333
EcamPrx75 681 0 3..333 1..331
PtPrx02 640 0 1..333 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23754232..23754468 237 N° 2 23753694..23753882 189 N° 3 23753183..23753348 166 N° 4 23752620..23753029 410
complement(join(23752620..23753029,23753183..23753348,23753694..23753882,2375423 2..23754468))


exon

Literature and cross-references EgrPrx75 (Eucgr.D01322 / Egrandis_v1_0.018909m)
DNA ref. Phytozome 12:   scaffold_4 (23754468..23752620)
Protein sequence: EgrPrx75 (Eucgr.D01322 / Egrandis_v1_0.018909m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (309)
PWM (Da):   %s   37477.32 (34884.9)  
PI (pH):   %s   8.39 (8.02) Peptide Signal:   %s   cut: 25 range:25-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASKALIFLALLSFSAVSPRPAIAEINEEDKPGLVMNFYKDTCPQAEDIIKEQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRSLSEKETDRSFGLRNFRYLDTIKEAVERECPGVVSCADILVLSARDGIVALGGPHFPLKTGRRDGRKSRADVVEQYLPDHNESISVVLDRFAAMGINTPGVVALLGAHSVGRTHCVKLVHRLYPEVDPALNPDHIEHMLHKCPDAIPDPKAVQYVRNDRGTPMVLDNNYYRNILDNKGLLIVDHQLATDKRTKPYVKKMAKSQDYFFKEFARAITILSENNPLTGDQGEIRKQCNVANKHH*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCAAAGCTCTCATCTTCTTGGCTCTCTTATCTTTCTCAGCTGTGTCACCGAGACCTGCCATTGCAGAGATCAATGAGGAAGACAAGCCTGGTCTTGTGATGAACTTCTACAAG
GACACCTGCCCTCAAGCCGAGGATATCATCAAGGAGCAAGTGAAGCTCCTCTACAAGCGCCACAAGAACACTGCATTCTCCTGGCTGAGGAACATCTTCCATGACTGTGCTGTTCAG
GTA
TCAAACCTGCGTTGTGCTTAACGTCAGTTCCGCTCGATTGTTTTCAAGTTTAACGAGCAACATTTGTGTTTTTCTTGCAAAAGAAACAGCTTTTCCGCTATTTTTCACTCATTTTCCAGC
ATTTTTTTGTGCTCGGGTTTGACCAATGAGCTTTATCTGGAGTCAAGAACCCAGATCTCCCTAGTGAGGCTTGGTCGAGCTAGCAAAATGAGAAATTATCAAACTCGATCTCTTAAGTTT
TGGAATTGAGATTTAAGTTCAAGAAGTATACTATGTTGACTCAACTCAGCTCCTTTTTTGCGTTAGTGTTCGGAAACGTCATTTGCCTTGTGTGATGTGAATGCAGTCATGTGATGCTTC
CCTGCTCTTGGATTCGACGCGGAGGAGCTTGTCGGAGAAAGAAACCGACCGGAGTTTCGGTCTGAGGAACTTCAGGTACCTGGACACCATTAAAGAAGCTGTGGAGAGAGAATGCCCTGG
AGTTGTTTCTTGTGCGGACATCCTGGTCTTGTCTGCTAGAGATGGCATAGTCGCG
GTACTCACTCTTGTTGTTGTCCTAATTATGATGTTTGAGTATGAATATATAGAATCTGTAGATCT
TTGCTTCCTGTGTTTCTCTTTAATCTCTCTGTCGTATATGCTCTGTATATTTAATAACCCTTTCCTTTTGTTTTGAGTGAACAAAATATCTATCTGTACACTAGTCCTTTTGGCTAGTGT
TTGCGAAATCTGATAAGTTCACATGTTTCCCCTGGGGATGAAGGTACCTCAACTCTGCCATATTTTACCCTTCTTTCTCAGTAACTTGTCAGCTTGTTCTCATATGGACATTCAAGAAAA
TTGGTGAAATCTGGTCTTGAAATTCACTCTCTCTGAGCAGCTAGGAGGCCCTCACTTTCCCCTGAAAACTGGGAGGAGAGATGGTAGGAAGAGCCGAGCTGATGTGGTCGAACAATACCT
TCCAGATCACAATGAAAGCATTTCAGTGGTGCTCGACAGATTCGCGGCCATGGGCATCAATACACCAGGAGTGGTTGCTTTACTAG
GTAATTTACTATATGATCCTAGTGCTTCACCATC
AGCTTTATTTTCCTAAAGTTGTTTAGCCTGCATATTGTAAAATCAGTATGCATGTTTGGTTATAATAATCTTAGTTGCTTGGTTGGTGCATCATTCTGTCTCCTGAATTTGTCTAACAGG
AGCTCACAGCGTGGGCCGAACCCACTGCGTCAAGCTGGTTCACCGGCTCTATCCAGAGGTCGACCCTGCGCTGAACCCAGACCACATTGAGCACATGCTTCACAAGTGCCCGGATGCGAT
CCCAGACCCGAAGGCTGTGCAGTACGTGAGGAATGACAGAGGCACGCCGATGGTGCTGGACAACAATTACTACAGGAACATACTGGACAATAAGGGCTTGTTAATCGTGGACCACCAGCT
TGCCACTGACAAGCGGACCAAGCCCTATGTAAAGAAGATGGCCAAGAGCCAGGACTACTTCTTCAAGGAGTTTGCAAGGGCCATCACCATCCTCTCTGAGAACAACCCTCTCACTGGTGA
CCAAGGTGAGATCAGGAAGCAGTGCAATGTTGCCAACAAGCACCACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCCAAAGCTCTCATCTTCTTGGCTCTCTTATCTTTCTCAGCTGTGTCACCGAGACCTGCCATTGCAGAGATCAATGAGGAAGACAAGCCTGGTCTTGTGATGAACTTCTACAAG
GACACCTGCCCTCAAGCCGAGGATATCATCAAGGAGCAAGTGAAGCTCCTCTACAAGCGCCACAAGAACACTGCATTCTCCTGGCTGAGGAACATCTTCCATGACTGTGCTGTTCAG
TCA
TGTGATGCTTCCCTGCTCTTGGATTCGACGCGGAGGAGCTTGTCGGAGAAAGAAACCGACCGGAGTTTCGGTCTGAGGAACTTCAGGTACCTGGACACCATTAAAGAAGCTGTGGAGAGA
GAATGCCCTGGAGTTGTTTCTTGTGCGGACATCCTGGTCTTGTCTGCTAGAGATGGCATAGTCGCG
CTAGGAGGCCCTCACTTTCCCCTGAAAACTGGGAGGAGAGATGGTAGGAAGAGC
CGAGCTGATGTGGTCGAACAATACCTTCCAGATCACAATGAAAGCATTTCAGTGGTGCTCGACAGATTCGCGGCCATGGGCATCAATACACCAGGAGTGGTTGCTTTACTAG
GAGCTCAC
AGCGTGGGCCGAACCCACTGCGTCAAGCTGGTTCACCGGCTCTATCCAGAGGTCGACCCTGCGCTGAACCCAGACCACATTGAGCACATGCTTCACAAGTGCCCGGATGCGATCCCAGAC
CCGAAGGCTGTGCAGTACGTGAGGAATGACAGAGGCACGCCGATGGTGCTGGACAACAATTACTACAGGAACATACTGGACAATAAGGGCTTGTTAATCGTGGACCACCAGCTTGCCACT
GACAAGCGGACCAAGCCCTATGTAAAGAAGATGGCCAAGAGCCAGGACTACTTCTTCAAGGAGTTTGCAAGGGCCATCACCATCCTCTCTGAGAACAACCCTCTCACTGGTGACCAAGGT
GAGATCAGGAAGCAGTGCAATGTTGCCAACAAGCACCACTAG

Retrieve as FASTA