Entry information : EgrPrx134 (Eucgr.I00717 / Egrandis_v1_0.019168m)
Entry ID 8036
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx134 (Eucgr.I00717 / Egrandis_v1_0.019168m)
Name (synonym) EgrPrx134 (Eucgr.I00717 / Egrandis_v1_0.019168m)
Class Class III peroxidase    [Orthogroup: Prx011]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx134
start..stop
S start..stop
EglPrx134 673 0 1..329 1..329
EguPrx134 670 0 1..329 1..329
CroPrx25 548 0 20..329 24..333
RcPrx21 546 0 23..329 28..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15058674..15058889 216 N° 2 15059012..15059212 201 N° 3 15059336..15059501 166 N° 4 15060010..15060416 407
join(15058674..15058889,15059012..15059212,15059336..15059501,15060010..15060416 )


exon

Literature and cross-references EgrPrx134 (Eucgr.I00717 / Egrandis_v1_0.019168m)
DNA ref. Phytozome 12:   scaffold_9 (15058674..15060416)
Protein sequence: EgrPrx134 (Eucgr.I00717 / Egrandis_v1_0.019168m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (304)
PWM (Da):   %s   35753.89 (32843.5)  
PI (pH):   %s   9.06 (9.33) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALFRLFALWSLAICFCLCPHTTSAQLRQNFYANVCPNVEGIVRNAVRQKFQQTFVTVPGTLRLFFHDCFVQGCDASVIVASTSTNKAEKDHPDNLSLAGDGFDTVIKAKAAIDAVASCRNKVSCADILAMATRDVIALSGGPSYAVELGRLDGLSSTAASVNGRLPHPTDNLSQLNALFAANGLSQTDMIALSAAHTLGFSHCDKFSNRIYNFSRQKAVDPTLNPNYATQLQGMCPRNVDPRIAINMDPNTPRTFDNMYFKNLQNGKGLFTSDQVLFTDPRSKPTVNAWASNSRAFQSAFISAMTKLGRVGVKTGKNGNIRRDCAVFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGTTCCGACTCTTCGCGCTGTGGTCGCTGGCCATATGCTTCTGCCTCTGTCCTCACACGACGTCAGCTCAGCTGAGGCAGAACTTCTACGCCAACGTCTGCCCGAATGTGGAG
GGCATCGTGCGCAATGCCGTTCGACAGAAGTTCCAGCAAACATTCGTCACTGTCCCCGGAACTCTTCGTCTCTTTTTCCATGATTGCTTCGTCCAG
GTAATTTCGATTCCCCCCATGATT
GACTTTGAAGACCCATTTGGTCATTTTTCGTTAGAGATTGACCAATCAGCAATCTTTTATTGGCCTTTCGTGTTTTGGGACTTGGTTTGGATCGATAGGGTTGTGATGCTTCGGTGATAG
TGGCGTCCACCTCAACCAACAAGGCGGAGAAGGATCATCCAGACAACCTGTCGTTGGCCGGAGATGGGTTCGACACTGTGATAAAGGCGAAGGCGGCCATCGACGCAGTTGCGAGCTGCC
GGAACAAGGTCTCGTGCGCGGACATCCTAGCCATGGCCACCCGAGATGTCATCGCACTG
GTGGGTGTGCTAATTTCTCACGTTGAAATAGTTTTCGAGTCATCACAATGCCGATCGTTGT
GAGCCGAATGTCGATCTTGGTGCTGTGCATGAAATTGAAAGAGCGAATTGGTGAAATTGCAGTCGGGAGGGCCGTCCTATGCAGTGGAATTAGGGAGATTGGACGGGCTGAGTTCAACGG
CGGCGAGCGTCAATGGGAGGCTCCCTCATCCGACCGACAACCTTAGCCAGCTCAACGCCTTGTTTGCTGCTAATGGCCTCTCCCAAACTGACATGATCGCACTCTCAG
GTAACCGCGCGT
GCTCAGCACGGTCCCATCGCATGTGGATGTATAAAGTGAATACAACATGGTCGACTATTCAACAAATTAACTTGGATAGTTTCTAGTAACTACTAAATATGCTCCTTAAATTTATAACCC
CTTCTCGAGGGGTGCTACTGCTTCATCATGTGATCAAATTTGTTTGATAGACTATTAAGTTAATCATTATCACCATATTATCTGATATATACTTCAAGAAACGTGAATTTATTGGTTTTT
TTAATTGATCAAACAAACTATAAAACACGAGCCGGTGAGATTGCCCCGATCAGAGATGGTACATTGCTGACAAACCATTATAAGTATGTGCAACTGGAACATGGAAAGGGTCAATTATAT
AATGAGATTTGGTGAGTTTGATGCAGGTCATCTTGCTGTCACTCAATAATATTATACACATTATCGTCATATCTATCTTTACAACATGATTAGGTGTCCCAATCTATTTGTCTTGTTATC
CATGGTCATTTTACAGCTGCCCACACGCTCGGATTCTCCCACTGCGACAAATTCTCGAACCGGATATACAACTTCAGCCGCCAGAAGGCGGTGGACCCGACCCTGAACCCGAACTACGCG
ACCCAGCTACAGGGCATGTGCCCCCGGAACGTCGACCCGAGGATAGCCATAAACATGGACCCGAACACCCCCCGGACCTTCGACAACATGTACTTCAAGAACCTGCAAAACGGGAAGGGC
CTTTTCACCTCGGACCAAGTCCTCTTCACTGACCCGCGGTCAAAACCCACCGTGAACGCATGGGCCAGTAACTCCCGGGCCTTCCAGAGCGCCTTCATCTCCGCCATGACCAAGCTGGGC
CGGGTTGGGGTCAAGACCGGGAAGAACGGAAACATCCGCCGCGACTGCGCCGTATTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTGTTCCGACTCTTCGCGCTGTGGTCGCTGGCCATATGCTTCTGCCTCTGTCCTCACACGACGTCAGCTCAGCTGAGGCAGAACTTCTACGCCAACGTCTGCCCGAATGTGGAG
GGCATCGTGCGCAATGCCGTTCGACAGAAGTTCCAGCAAACATTCGTCACTGTCCCCGGAACTCTTCGTCTCTTTTTCCATGATTGCTTCGTCCAG
GGTTGTGATGCTTCGGTGATAGTG
GCGTCCACCTCAACCAACAAGGCGGAGAAGGATCATCCAGACAACCTGTCGTTGGCCGGAGATGGGTTCGACACTGTGATAAAGGCGAAGGCGGCCATCGACGCAGTTGCGAGCTGCCGG
AACAAGGTCTCGTGCGCGGACATCCTAGCCATGGCCACCCGAGATGTCATCGCACTG
TCGGGAGGGCCGTCCTATGCAGTGGAATTAGGGAGATTGGACGGGCTGAGTTCAACGGCGGCG
AGCGTCAATGGGAGGCTCCCTCATCCGACCGACAACCTTAGCCAGCTCAACGCCTTGTTTGCTGCTAATGGCCTCTCCCAAACTGACATGATCGCACTCTCAG
CTGCCCACACGCTCGGA
TTCTCCCACTGCGACAAATTCTCGAACCGGATATACAACTTCAGCCGCCAGAAGGCGGTGGACCCGACCCTGAACCCGAACTACGCGACCCAGCTACAGGGCATGTGCCCCCGGAACGTC
GACCCGAGGATAGCCATAAACATGGACCCGAACACCCCCCGGACCTTCGACAACATGTACTTCAAGAACCTGCAAAACGGGAAGGGCCTTTTCACCTCGGACCAAGTCCTCTTCACTGAC
CCGCGGTCAAAACCCACCGTGAACGCATGGGCCAGTAACTCCCGGGCCTTCCAGAGCGCCTTCATCTCCGCCATGACCAAGCTGGGCCGGGTTGGGGTCAAGACCGGGAAGAACGGAAAC
ATCCGCCGCGACTGCGCCGTATTCAATTGA

Retrieve as FASTA