Entry information : EgrPrx135 (Eucgr.I01176 / Egrandis_v1_0.019001m)
Entry ID 8040
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx135 (Eucgr.I01176 / Egrandis_v1_0.019001m)
Name (synonym) EgrPrx135 (Eucgr.I01176 / Egrandis_v1_0.019001m)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx135
start..stop
S start..stop
EglPrx135 680 0 1..331 1..331
EguPrx135 668 0 1..331 1..331
PpePrx08 471 1e-168 31..331 32..332
NtPrx36-1A 468 1e-167 14..331 9..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 22754571..22754801 231 N° 2 22754116..22754307 192 N° 3 22753842..22754007 166 N° 4 22753153..22753559 407
complement(join(22753153..22753559,22753842..22754007,22754116..22754307,2275457 1..22754801))


exon

Literature and cross-references EgrPrx135 (Eucgr.I01176 / Egrandis_v1_0.019001m)
DNA ref. Phytozome 12:   scaffold_9 (22754801..22753153)
Protein sequence: EgrPrx135 (Eucgr.I01176 / Egrandis_v1_0.019001m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (309)
PWM (Da):   %s   36054.27 (33544.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.35 (5.71) Peptide Signal:   %s   cut: 23 range:23-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASKHLLLFQITLISLILAVSCFPAHSPIGQLSPYYYDGSCPRLQWIVRSNVWAAFQKDTRIAASLLRLHFHDCIVDGCEGSVLLDDTVDMKGEKNALPNRNSLRGFEVIDAIKADLENFCPFTVSCTDILTLAAREAVYMSGGPYWAVLLGRRDGITASDKSANEQIPSPIEPLDNIIAKFTSKGLELKDVVVLSGGHTIGFAQCFTFKRRLFNFKGSGKPDPTLDTSLLSSLQSTCPNKDASNTNLAPLDSTVDKFDNYYYANLVNNSGLLESDQALIADARAAPLVNSYTTNPTLFYNDFAASMLKLGNVGILTGQSGQIRKQCGSVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCAAGCACCTTTTGCTATTCCAAATCACATTGATTAGCTTGATCTTAGCAGTCTCTTGCTTCCCTGCTCATAGCCCGATAGGCCAGCTCTCTCCGTATTATTATGACGGATCG
TGCCCTCGCTTGCAATGGATCGTCAGATCCAACGTTTGGGCAGCCTTCCAGAAAGATACAAGGATTGCTGCCTCTCTTCTTCGATTACACTTTCATGACTGCATCGTCGAT
GTAAGTAAT
TCGATCCAAGTGTCGTCATGATTGCAGCTTATTTGCGTGCACTTTTCCTCGATGATAATTTTAGGTTCTGTCGCTTCTTCTCGGTTTGGCGACTTAGCAGAGACATGTACAGCACGTTTT
ATTAGGAAAAGTCTTGACGGCATATGTTTCGCATTTGCATTGCTACCTAACATCGTGACATGGTTAAGCATGTGACCGGACTCGAGGCTTATGTTATCCCTAGACACTGAACAACACTAC
ACCATCGATGTTAGGGCTGCGAAGGATCCGTGCTTCTTGATGACACCGTAGACATGAAGGGCGAGAAGAACGCCTTGCCAAATCGCAACTCTCTCCGAGGCTTTGAAGTCATCGACGCTA
TAAAAGCCGACCTCGAGAATTTCTGCCCCTTCACCGTCTCGTGCACTGATATACTCACCCTAGCTGCAAGAGAAGCCGTCTATATG
GTACCTTAATAAACCCCAGTTCTCTTCTTCACGA
ATACAATAGTTGAGCATGGCTCCTAAGCTAATAAGCACTTAATGAAAAACTAATTGGCCTTGATGGAGTTTTAGTCAGGTGGACCTTATTGGGCCGTACTATTGGGAAGAAGAGATGGAA
TCACGGCTAGCGACAAGTCGGCCAATGAACAGATACCGTCGCCTATTGAGCCTTTGGATAACATCATTGCTAAGTTCACTTCAAAGGGTCTGGAGTTGAAGGATGTTGTGGTCCTCTCAG
GTACTTAATTTTCTCTGCATGCAATAGTAGTGAACAAAAAGCAGACTTCTCCGAGCAATACCAAGGCCAGAAGAGCAATAACCACAGAGAAATAAAGTCATATGAACTATTTTTGGTCTA
ACAGAATATAGACAGAATTAATGATCACGATCACAATAAGAAAGACGTGAAATCCATGTCTTTTTCATTGATACGAGATAACCAAGGTATGTTTGGAAGCGCTGTATATGTAAAGGAAGC
GAGTCTAATGAGTTGTCCTCATTTTTTCAAAATCACTTTTAGGAGGGCACACCATAGGCTTTGCCCAGTGTTTCACCTTCAAGAGGAGGCTCTTCAACTTCAAAGGGTCCGGCAAGCCTG
ACCCGACCTTGGACACCTCCCTCTTATCGAGCCTCCAGAGCACATGCCCCAATAAAGACGCCTCCAACACCAACCTCGCTCCTCTCGACTCCACTGTGGACAAATTCGACAACTACTACT
ACGCCAACCTGGTGAACAATTCGGGCCTACTCGAATCGGATCAAGCCTTGATCGCTGACGCGAGAGCCGCCCCACTCGTCAATTCCTACACCACCAACCCCACGCTGTTCTATAATGATT
TCGCCGCTTCCATGTTGAAGTTAGGCAATGTTGGAATTCTCACTGGGCAGAGTGGGCAGATTAGGAAGCAGTGTGGCTCCGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCAAGCACCTTTTGCTATTCCAAATCACATTGATTAGCTTGATCTTAGCAGTCTCTTGCTTCCCTGCTCATAGCCCGATAGGCCAGCTCTCTCCGTATTATTATGACGGATCG
TGCCCTCGCTTGCAATGGATCGTCAGATCCAACGTTTGGGCAGCCTTCCAGAAAGATACAAGGATTGCTGCCTCTCTTCTTCGATTACACTTTCATGACTGCATCGTCGAT
GGCTGCGAA
GGATCCGTGCTTCTTGATGACACCGTAGACATGAAGGGCGAGAAGAACGCCTTGCCAAATCGCAACTCTCTCCGAGGCTTTGAAGTCATCGACGCTATAAAAGCCGACCTCGAGAATTTC
TGCCCCTTCACCGTCTCGTGCACTGATATACTCACCCTAGCTGCAAGAGAAGCCGTCTATATG
TCAGGTGGACCTTATTGGGCCGTACTATTGGGAAGAAGAGATGGAATCACGGCTAGC
GACAAGTCGGCCAATGAACAGATACCGTCGCCTATTGAGCCTTTGGATAACATCATTGCTAAGTTCACTTCAAAGGGTCTGGAGTTGAAGGATGTTGTGGTCCTCTCAG
GAGGGCACACC
ATAGGCTTTGCCCAGTGTTTCACCTTCAAGAGGAGGCTCTTCAACTTCAAAGGGTCCGGCAAGCCTGACCCGACCTTGGACACCTCCCTCTTATCGAGCCTCCAGAGCACATGCCCCAAT
AAAGACGCCTCCAACACCAACCTCGCTCCTCTCGACTCCACTGTGGACAAATTCGACAACTACTACTACGCCAACCTGGTGAACAATTCGGGCCTACTCGAATCGGATCAAGCCTTGATC
GCTGACGCGAGAGCCGCCCCACTCGTCAATTCCTACACCACCAACCCCACGCTGTTCTATAATGATTTCGCCGCTTCCATGTTGAAGTTAGGCAATGTTGGAATTCTCACTGGGCAGAGT
GGGCAGATTAGGAAGCAGTGTGGCTCCGTGAACTAA

Retrieve as FASTA