Entry information : EgrAPx09 (Eucgr.I01408 / Egrandis_v1_0.021866m)
Entry ID 8041
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrAPx09 (Eucgr.I01408 / Egrandis_v1_0.021866m)
Name (synonym) EgrAPx09 (Eucgr.I01408 / Egrandis_v1_0.021866m)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrAPx09
start..stop
S start..stop
EglAPx09 589 0 1..287 1..287
EguAPx09 588 0 1..287 1..287
LsaAPx02 501 0 1..287 1..285
RcAPx02 500 0 1..287 1..288
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24537765..24537877 113 N° 2 24537528..24537652 125 N° 3 24536514..24536563 50 N° 4 24535990..24536055 66
N° 5 24535865..24535913 49 N° 6 24534894..24534976 83 N° 7 24534728..24534807 80 N° 8 24534536..24534638 103
N° 9 24533762..24533956 195  
complement(join(24533762..24533956,24534536..24534638,24534728..24534807,2453489 4..24534976,24535865..24535913,24535990..24536055,24536514..24536563,24537528..2 4537652,24537765..24537877))


exon

Literature and cross-references EgrAPx09 (Eucgr.I01408 / Egrandis_v1_0.021866m)
DNA ref. Phytozome 11:   scaffold_9 (24537877..24533762)
EST ref. GenBank:   HO766568
Protein sequence: EgrAPx09 (Eucgr.I01408 / Egrandis_v1_0.021866m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   288
PWM (Da):   %s   31503.22 Transmb domain:   %s   o258-280i
PI (pH):   %s   6.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPVVDTEYLKEIDKARRHLRALIAYKNCAPIMLRLAWHDAGTYDARTKTGGPTGSIRNEEEYSHGANAGLKIALDFCEDVKSKCPRITYADLYQLAGVVAVEVTGGPTIDFVPGRKDSRVSPNEGRLPDANQGPPHLRDIFYRMGLSDKDIVALSGAHTLGRAHPERSGFDGPWTQEPLKFDNSYFVELLKGESEGLLKLPTDKALLEDPAFRPYVELYAKDEDAFFRDYVISHKKLSELGFTPSSSGSKTVANGAVLAQGAVGVAVAAAVVILSYFYEVRKKMK*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTGCCGGTGGTCGACACGGAGTACCTGAAGGAGATCGACAAGGCCCGCCGCCACCTCCGCGCGCTCATCGCCTACAAGAACTGCGCTCCGATCATGCTCCGGCTGGCGTAAATC
TCGCTTCGCCCCCGCCTCGATCGGCGACGACGGTTTTCTTTCTTCGATTCGATTAGCTCGCCGGTTTCTGACGTCCGAAGGTTTCCGCCGATTCGGTCTTTGCAGGTGGCACGACGCCGG
GACCTACGACGCGAGGACGAAGACCGGCGGCCCCACCGGCTCGATCAGGAACGAGGAGGAGTACTCCCACGGCGCCAATGCCGGCTTGAAGATCGCTCTTGATTTTTGCG
GTGAGCTCTC
CGCTCTTTCCGAGCTACCTGTCTTCGGTTCTCCGCCTTCGCTGTTTTCGTTCCTTCGGCGGAGCCGTGTCTTCGCCTGTCCAGCGTCCCGTGCCGAAGTAGTTGCTGGAGTTCATCTATT
CATGCGTTGACAGCAGTTCGGAGGGTGTGCATGCAATTGTAGGTTGCGATTGTGCGATTCCCGTTGCGTGCTTATATGATGCTAAATAGATATAGGTGCTTCGAGATTAGAAAGTCCAAT
TTCCATGGACGTCTGTCTTCTAATACAAGAAGTCTGCTTCAATTATAGCTTTCCTTCACTTGCTGCTGTTGGAGGCCTTCGCGTTTGCTTATGTTTTGTGTTATTTGATGAGTAATGTTT
GACTTGATCAATTATCTTACGATGTTTAGTGCTCGGGGTGCCGGTTGTCTGTTATACTGAAGACAGTTAACGAGTTTGTCAACGTGATGCTATGTACTTACAAATTCTTGAAAGGCCAAG
CAGTGCGTTTGCATACTCTGATTTACTTTTGTTACTTGCTAGGTTCATTTAACCAAGTTTAGATATATTTGCAATATTCATCAGTATAGAATGAATGAAGATAATTATTACTCCAGACAT
TGTTCCTTCCTTTAAAGAAATCCCTACAGTTCTCATAAAGTTGAGGTATATGTAATATCCTATGTTCAGTTTATGAGAGCATGCTTAACATGGGTGGTTTAGTGTTCTGTCTAGTGCTTC
CATGATTGTTGACCAAGGAAATCCTAAGACTGTTGCATATATTTTACACGAGTCAACTTGTAGATATACACGAGTCAACTTGTAGATATGTTATGTTTCTAATAGTTTCAACTATACAAG
TGTAGGAACCCATCATGGATAAGGTCATAGCTTTGATGAATAGACTTTTTTGCAAATGGAGTTGAGATATAACTTCAATCAGTATATTTACATTTGCTTTTATGTTGGATACAGAGGATG
TGAAGTCCAAATGTCCGAGGATTACATATGCAGATCTATACCAG
GTGAAATGACTGTTTAAAGGATTCGTTCTTCTGTCTTACATATCACGAGTTGGCTCCCCCAATAGGTGGACAAAAT
CATTGTTAATATAACAAGCTTAGTTTATAAAAGACTTTGAATTCTTGCCATTTAACTTTGATGTTTTCTGCCCTCCAGCATGCAACATCTTCAAAACTAATATGCATGCGCGTGGTGAAG
CCCTTAATTGGCATAACCCAGAAATTCTTTATTTTGAGATACTTTAGGAACAAATCTTTATTTATCTTATTTTTAGTCCTCTGGGCATTTAGTTCTCAGTTGTTTATAGGAAATCTCCTC
TGTCTAGTACAACTGGTAACGTCCTTGGTTGTTTAGTGGTTGAATAATGTTATATTATAGCTGATCAATTCTAGTGGTTACTATAAATAATGGCTTATCAATTTGCGAGTATTGATCATT
ATGAGCGAATTGCCTGTTTCAGCTAGCAGGAGTTGTCGCAGTAGAAGTCACTGGAGGTCCCACAATTGACTTTGTTCCTGGAAGAAAGGTACTCTGTTTTATCTGTATGTGAGCAAGATA
ATTCTTACGAGTGCCTTATTCATTAAGTTTTTTTCTATCTGCAGGATTCAAGAGTTTCTCCAAATGAAGGAAGACTTCCAGATGCTAATCAAGGTATTCTGTTGTGTCAACTTTCCCTTT
GTTGTTTGGCCTCCCTTCATTTCCCTCCATCCCTCCCTCCAAATATTATGGCCCACTCTGCTTCTTATTGCTCCAGGCAAAAAGTTAAATAACTATTTATTGTTTTCCTTATGGTTGCTG
CCTGTTAATGTTGAAATGTATGTCCATCTCATCTGAATGTCAATTAGTAAATTTACAGAGGAATGATTTGAATGAGATAAGAAGTGCATTGAAACAAGGGTATCAGAGCTAACTGACAGT
CAGATGTTGTCCATCCCATCTAAATGTCAGTAAGTTTCCCGATTAAGAACCTCACATGCAAAATGGGCACAGTGCCTATTTTGTATGAGTCAGCTGTTGTGAACTCACCACAAAGAATGA
GTTGAGAGAGAAGTGCTGGGATTTGAACTCTTGATCTGTCATCTGAAACGGTACTAGAATATCCAACCTAAAAGTTTAAGCATTGATGTGGAGAGAGGCAACATGTATGTAAGAAAACTT
TAGCCATCAGGTGAGAGAGACTATATGCGTGTGAGACACATTATGACCATGTTTTCAAGGGATGTTTGATTATCCTAAAAGACAATATTACTACTCATGCGAACCCAGTTTGATATTTCA
CATGATATTTTACATCTGCAACTCACTCTAGCTGAGTGAAAGGAGGCTCAAATGAAAGGAGGCCTTCAACCGTAGCTTGGTTAAGCTTTATCAATTTGTGATATTCACGTTTAACAGTCC
ACTGCCTACCTATAACTTATCATAGCTCTAAATCCATCGGAGATTTTTCATGCATTATAATTCTTTTATTGGGGAAATACATGTACATTTTGCTTGAAGGGTATTTGAATTTTTTTCTAA
ACTTGTCATTGCTGGATGTAGGTCCTCCACATCTAAGGGACATCTTTTACAGGATGGGCCTGTCAGACAAGGACATAGTGGCCTTATCAGGGGCTCATACACTGGTAATTTCTATTTCTG
CTTGGATTTACATTCAAGGTCAGCTGGGCATGTGCAACCACACTTGTTATATTTTCATTCTTGTTTCTAGGGAAGGGCACACCCGGAAAGATCTGGATTTGATGGTCCTTGGACTCAGGA
ACCCCTTAAGTTTGATAATTCCTATTTTGT
GTAAGATTTCATCTTTTCACCAGATGCATTTTCTACATTTCAGCTGGAGCATTATAGAGCCAGATACTAATTGATCATTTTTGATACAGC
GAGTTGTTGAAAGGGGAATCAGAGGGGCTGCTGAAACTGCCAACTGACAAGGCATTGCTGGAAGATCCTGCATTTCGCCCTTATGTTGAGTTGTATGCGAAG
GTAAATAGGCTTTTCGCG
TGTTCTGGTGACTCCATTGATAAATCTATAAAATTGAATTGCAGTTACATGGTTTCCTTTTGTAAATTTGTTTTTGATGAAACTACCCCACCTGCACCACTATCTCATTTCCTTATGCAC
ATGGTCTACAACCCTCTGATGCTGCTGTCCTTGGTTTTGCCAAGATTGAAATAAGATGGAAAGTGTTTTTCATGGAATTTATGCTGTATAGGCTTGTGATGCTAAAAAATAAGCATTCAG
TCTGTTCCATCACCATCTTCTACGTAGAGACCAGGAATCTTCATAATGAGATCGCGCATCAAATGTTGGGTAGATATATACATGTGTTGGGATGGATATATTATGTGGATCCCTGAAACC
TCTAGGCTAGAGCATCATTTTTGTGCTACTGGGAACACCTGATTTGATATTTGAATTGGTTGTTGTTCCCGCAACTCTCTCACTGTGGTTGGCATGACCTTGAAGAGAGACAAACGGACA
ATTTGATACTCTGCTTCTTTTTCCCCTCGTTTTCTTTTGTCATATGCTCTTCTTTCCCTAATGTTGTCAAGCATGTGGCAGGATGAGGATGCATTTTTCAGAGATTATGTAATCTCGCAT
AAGAAGCTCTCTGAACTGGGGTTCACGCCAAGTTCTTCAGGCAGCAAGACAGTAGCGAATGGTGCTGTATTGGCACAAGGTGCTGTCGGAGTGGCAGTGGCTGCAGCCGTGGTGATCTTG
AGCTACTTCTATGAAGTGCGCAAGAAAATGAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTGCCGGTGGTCGACACGGAGTACCTGAAGGAGATCGACAAGGCCCGCCGCCACCTCCGCGCGCTCATCGCCTACAAGAACTGCGCTCCGATCATGCTCCGGCTGGCGTGGCAC
GACGCCGGGACCTACGACGCGAGGACGAAGACCGGCGGCCCCACCGGCTCGATCAGGAACGAGGAGGAGTACTCCCACGGCGCCAATGCCGGCTTGAAGATCGCTCTTGATTTTTGCG
AG
GATGTGAAGTCCAAATGTCCGAGGATTACATATGCAGATCTATACCAG
CTAGCAGGAGTTGTCGCAGTAGAAGTCACTGGAGGTCCCACAATTGACTTTGTTCCTGGAAGAAAGGATTCA
AGAGTTTCTCCAAATGAAGGAAGACTTCCAGATGCTAATCAAG
GTCCTCCACATCTAAGGGACATCTTTTACAGGATGGGCCTGTCAGACAAGGACATAGTGGCCTTATCAGGGGCTCAT
ACACTG
GGAAGGGCACACCCGGAAAGATCTGGATTTGATGGTCCTTGGACTCAGGAACCCCTTAAGTTTGATAATTCCTATTTTGTCGAGTTGTTGAAAGGGGAATCAGAGGGGCTGCTG
AAACTGCCAACTGACAAGGCATTGCTGGAAGATCCTGCATTTCGCCCTTATGTTGAGTTGTATGCGAAG
GATGAGGATGCATTTTTCAGAGATTATGTAATCTCGCATAAGAAGCTCTCT
GAACTGGGGTTCACGCCAAGTTCTTCAGGCAGCAAGACAGTAGCGAATGGTGCTGTATTGGCACAAGGTGCTGTCGGAGTGGCAGTGGCTGCAGCCGTGGTGATCTTGAGCTACTTCTAT
GAAGTGCGCAAGAAAATGAAGTGA

Retrieve as FASTA