Entry information : EgrPrx163 (Eucgr.K00808 / Egrandis_v1_0.030892m)
Entry ID 8043
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-25 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-12-04 (Qiang Li)
Peroxidase information: EgrPrx163 (Eucgr.K00808 / Egrandis_v1_0.030892m)
Name (synonym) EgrPrx163 (Eucgr.K00808 / Egrandis_v1_0.030892m)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx163
start..stop
S start..stop
EglPrx163 658 0 1..326 1..326
EguPrx163 656 0 1..326 1..326
EcamPrx163 650 0 1..326 1..326
EgrPrx161 629 0 1..326 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9232135..9232356 222 N° 2 9232788..9232976 189 N° 3 9233411..9233576 166 N° 4 9233688..9234091 404
join(9232135..9232356,9232788..9232976,9233411..9233576,9233688..9234091)


exon

Literature and cross-references EgrPrx163 (Eucgr.K00808 / Egrandis_v1_0.030892m)
DNA ref. Phytozome 12:   scaffold_11 (9232135..9234091)
Protein sequence: EgrPrx163 (Eucgr.K00808 / Egrandis_v1_0.030892m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   35083.91 (32216.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.19 (9.19) Peptide Signal:   %s   cut: 27 range:27-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAQKLLSLLVFQLALVAFILDVANAQGLKIGFYKNTCPQAEEIVKKAAASFISRAPSLAAPLLRMHFHDCFVRGCDGSVLLNSTSSNQAEKDAFPNLSLRGYQVIEAAKDALEKKCPGVVSCADILALVARDAVSMMNGPYWQVPTGRRDGRVSKLQDALNNLPAPTFSISALKSSFAAKGLSVKDLAVLSGGHTLGMSHCSSFTNRLYNFTGKNDADPSMDPNYVAQLKTKCKPNDATTIVEMDPGSAKTFDVDYYTLVSKRRGLFQSDAALLTDSTTKSYVQLQLTSKSTFAKDFGVSMVNMGNVGVLTGNSGEIRKKCYLVN*

Retrieve as FASTA  
Remarks Complete sequence genomic. Incorrect prediction from Phytozome (Only 5' end).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTCAGAAGCTTCTCTCTCTCCTGGTTTTCCAGCTCGCGCTCGTCGCTTTTATTCTCGACGTCGCCAATGCTCAAGGCCTCAAAATAGGGTTCTACAAGAATACGTGCCCTCAG
GCTGAGGAGATAGTTAAGAAAGCGGCGGCGAGCTTCATTTCTCGAGCCCCCTCTCTTGCCGCTCCTCTCTTGAGGATGCATTTCCATGACTGCTTCGTCAGG
GTACTTCCATTTTAGCGG
TTTATTCCACTCGAGTGACCCCGTTGCCATCAATTTCTCAATTACTGCATGTAGTTTCTTTGAATCAAACATATGCACATCACTCCCCACATCATTAATTTGTTGCGAAATAAGTTGTAG
CTATAATTAGTTGATGTGTAGAGATCTATCTTAATTAGATAACCAGTTTTATGTTAGTAGACACATTTGCGTTCCTTAAAACAATCCGTCTCCGGATAATCAAACTTGATTTTGGATGAC
ACCTATGTTGTGCGCAGTCAAATGTCTCGTTTTCCTGATTCGAAACTTCATGTCATGAAATGAGACAAATTTACCATATTACAAATTCATGCAGAGGCATGCACCTTCACCAAGTTCTAA
AGTTCCTTTTTTTTTTGCCTTTCTTTCCCTCTCTTTTTTGGGTTTATTTGCAGGGATGTGATGGCTCTGTGCTACTGAATTCAACATCTTCTAACCAAGCAGAGAAAGATGCGTTTCCAA
ACCTGTCACTGAGAGGATACCAAGTCATCGAAGCAGCTAAAGATGCCCTTGAAAAAAAATGTCCTGGTGTTGTCTCTTGTGCTGATATTCTTGCTCTAGTTGCTCGTGATGCAGTTTCCA
TG
GTAATTGATTAATTAAAGATTCGATTCCTATTGTATTCTAGCTAGGGATTTCTATAATACTGGTCATCAACGAAAATTGTTTCATAAATTCTATTTTTGTGATAAATCAAAATTATTT
TATCAATGATTTCGAATGGAATTGATTATCAAATTTTATTTCTGATGAGCGTGTGGACAACGCAAACTGATCAGAGTGCAAGTCATCTGCACAGGTCATAAACTTGGACTCAACTAGTTC
ATGTGGTTTGCAGAGTGCTACACTGGTTTTTGCGTCCACTCCCTTAAATAATAAATGATGTCAATTTATGAAATGTGACGTGATTTTTCTAAATTGTTGGTTGGATAACACAGCTAATGG
ATATGGAATTTCCAGTTTTTACTATGAAGGTATAGAGTAAGAATATCAAATATCTTTAACTTGTAATTGGTTTCAGATGAACGGTCCATATTGGCAAGTCCCCACAGGAAGGAGGGATGG
CAGAGTGTCTAAGCTTCAAGATGCCTTAAACAACTTGCCCGCTCCTACTTTCAGCATTTCTGCGCTTAAATCGTCCTTTGCCGCGAAGGGTCTCAGCGTCAAAGACCTTGCCGTTCTCTC
AG
GTACGAGACCAATCATAGTACATATACCTAACATTATTGAAAGTCCTAATCATTAGTTTATAATTTAAGTACAGTGAAATTAACGGTGTGGTTGATTCGATGATAATTCAGGAGGACA
CACCCTCGGAATGTCGCACTGTTCCTCCTTCACGAACCGTCTGTACAACTTCACTGGCAAGAACGACGCCGACCCATCCATGGACCCCAACTATGTCGCTCAGCTCAAGACCAAGTGCAA
GCCGAACGACGCCACCACCATCGTTGAGATGGACCCGGGGAGCGCCAAGACGTTTGACGTGGACTACTACACCCTCGTCTCCAAGAGGAGAGGCCTCTTCCAGTCTGATGCCGCGCTGCT
CACCGACAGCACCACCAAATCCTACGTGCAGCTCCAGCTGACGAGCAAATCGACATTTGCCAAAGACTTTGGCGTGTCCATGGTTAACATGGGGAACGTCGGCGTTCTCACCGGCAATTC
GGGCGAGATTAGGAAGAAATGCTATTTGGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTCAGAAGCTTCTCTCTCTCCTGGTTTTCCAGCTCGCGCTCGTCGCTTTTATTCTCGACGTCGCCAATGCTCAAGGCCTCAAAATAGGGTTCTACAAGAATACGTGCCCTCAG
GCTGAGGAGATAGTTAAGAAAGCGGCGGCGAGCTTCATTTCTCGAGCCCCCTCTCTTGCCGCTCCTCTCTTGAGGATGCATTTCCATGACTGCTTCGTCAGG
GGATGTGATGGCTCTGTG
CTACTGAATTCAACATCTTCTAACCAAGCAGAGAAAGATGCGTTTCCAAACCTGTCACTGAGAGGATACCAAGTCATCGAAGCAGCTAAAGATGCCCTTGAAAAAAAATGTCCTGGTGTT
GTCTCTTGTGCTGATATTCTTGCTCTAGTTGCTCGTGATGCAGTTTCCATG
ATGAACGGTCCATATTGGCAAGTCCCCACAGGAAGGAGGGATGGCAGAGTGTCTAAGCTTCAAGATGCC
TTAAACAACTTGCCCGCTCCTACTTTCAGCATTTCTGCGCTTAAATCGTCCTTTGCCGCGAAGGGTCTCAGCGTCAAAGACCTTGCCGTTCTCTCAG
GAGGACACACCCTCGGAATGTCG
CACTGTTCCTCCTTCACGAACCGTCTGTACAACTTCACTGGCAAGAACGACGCCGACCCATCCATGGACCCCAACTATGTCGCTCAGCTCAAGACCAAGTGCAAGCCGAACGACGCCACC
ACCATCGTTGAGATGGACCCGGGGAGCGCCAAGACGTTTGACGTGGACTACTACACCCTCGTCTCCAAGAGGAGAGGCCTCTTCCAGTCTGATGCCGCGCTGCTCACCGACAGCACCACC
AAATCCTACGTGCAGCTCCAGCTGACGAGCAAATCGACATTTGCCAAAGACTTTGGCGTGTCCATGGTTAACATGGGGAACGTCGGCGTTCTCACCGGCAATTCGGGCGAGATTAGGAAG
AAATGCTATTTGGTTAACTAA

Retrieve as FASTA