Entry information : EgrPrx109 (Eucgr.G02397 / Egrandis_v1_0.018499m)
Entry ID 8048
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx109 (Eucgr.G02397 / Egrandis_v1_0.018499m)
Name (synonym) EgrPrx109 (Eucgr.G02397 / Egrandis_v1_0.018499m)
Class Class III peroxidase    [Orthogroup: Prx074]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx109
start..stop
S start..stop
EcamPrx109 687 0 1..339 1..339
EguPrx109 647 0 1..339 1..339
EgrPrx105 639 0 1..339 1..339
EcamPrx105 637 0 1..339 1..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42547691..42547927 237 N° 2 42547331..42547522 192 N° 3 42547014..42547179 166 N° 4 42546436..42546860 425
complement(join(42546436..42546860,42547014..42547179,42547331..42547522,4254769 1..42547927))


exon

Literature and cross-references EgrPrx109 (Eucgr.G02397 / Egrandis_v1_0.018499m)
DNA ref. Phytozome 11:   scaffold_7 (42547927..42546436)
Protein sequence: EgrPrx109 (Eucgr.G02397 / Egrandis_v1_0.018499m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340 (309)
PWM (Da):   %s   36797.38 (33713.8) Transmb domain:   %s   i2-24o
PI (pH):   %s   4.49 (4.49) Peptide Signal:   %s   cut: 31 range:31-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAALFYPGILTMQFLAAIAFISGILGSGASDPPLTLDYYASSCPNVLEIIHQEMEREVLSDPRNAALVLRLHFHDCFVQGCDGSVLLDDTVMLRGEKTASPNINSLKGFEIIDRIKSNVESECPGIVSCADILTIAARDAVILVGGPYWDVPVGRKDSRSASYELANTNIPTPNQGLIAIIYKFLYLGLSVTDTVALSGAHTIGVARCENFRARIYGDYESTSGGSPLSEVHLSQLKSTCPAAGGGDNNIAPLDYETPYTFDNSYYHLLLNGEGLLNSDQELYSSVLALQTKQLVEQYALDVAAFFQQFSVSMVKMGNLMNPDSFLNGEVRKSCRFINA

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTTTATTTTATCCAGGAATCCTCACGATGCAGTTCTTGGCAGCCATCGCCTTCATTTCTGGCATTTTAGGTTCCGGTGCAAGCGACCCTCCACTGACGCTCGATTATTATGCA
TCCTCGTGCCCAAACGTGCTCGAAATAATCCACCAAGAAATGGAACGTGAGGTGCTCTCTGATCCGCGTAACGCTGCTTTAGTACTCCGTCTACACTTCCACGACTGCTTCGTTCAG
GTG
CATTGCTTATATCGTAACTCTATGCAATTTTATATTCTGTTGTGTTTAATTGAACATGTACTTTGGGATGAAAGTATGCGTTAGTAGTGACAACCATCTTGAAGCATGGATCAATCTGCA
AAGGGAGAGTGTTTTCTGAATGTTTTGGATGCGATGTTTTATTAGGGATGCGACGGTTCGGTCCTGTTGGATGATACGGTCATGCTACGAGGAGAGAAGACAGCTTCCCCAAATATAAAC
TCTCTAAAAGGTTTTGAAATCATCGATAGGATCAAGAGCAATGTTGAATCCGAATGCCCTGGAATTGTCTCTTGCGCTGATATATTGACCATTGCTGCTAGAGATGCTGTCATTCTG
GTA
TAGATTGTCCCTCTCTTTCTCTCTGAATTCCTCATTGGCATGTCAAATAATGTTCTGAATTATAACTTCTGTAGTTATTACTTGCTAACCAAGGAAGAATATCAGAAAATCAATGTGAGT
GATCTCGATTCTCTTTCATACTTGTTAGGTGGGCGGACCGTATTGGGATGTTCCGGTGGGGAGAAAAGACTCAAGAAGCGCAAGCTACGAGCTTGCAAACACCAATATTCCTACTCCGAA
TCAAGGCCTCATTGCCATCATTTACAAGTTCCTTTACCTCGGCCTCTCTGTCACCGACACCGTCGCACTTTCCG
GTAATTATTAAGTTTCTACTCCTCTTTAAGTGAGCGATCGAATTAC
TCACCCAAGGTGAGCTTATTGCCACAGAAGAAAGCGCGCTGATTAAGACTTGTATAGTATATTGCATGAGACTTTCCTTTTAACTATATGCACGTGTGAATCGCTAGGGGCTCACACGAT
CGGCGTGGCACGCTGTGAGAACTTCCGTGCAAGAATATATGGGGACTACGAATCGACGTCGGGCGGTAGTCCATTATCTGAAGTGCACCTGAGCCAATTGAAGTCCACATGCCCGGCCGC
AGGAGGGGGAGATAACAACATCGCGCCTTTGGACTACGAAACGCCCTACACGTTCGACAACTCCTACTACCATTTGCTCCTGAATGGAGAGGGATTGCTCAATTCTGACCAGGAACTATA
CTCAAGTGTATTGGCCCTTCAGACCAAGCAGCTTGTGGAACAGTATGCACTTGACGTGGCAGCCTTCTTTCAGCAGTTCTCCGTTTCCATGGTAAAGATGGGGAACCTCATGAATCCGGA
TAGCTTTCTCAATGGAGAAGTGAGGAAGAGTTGCAGATTCATCAATGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCTTTATTTTATCCAGGAATCCTCACGATGCAGTTCTTGGCAGCCATCGCCTTCATTTCTGGCATTTTAGGTTCCGGTGCAAGCGACCCTCCACTGACGCTCGATTATTATGCA
TCCTCGTGCCCAAACGTGCTCGAAATAATCCACCAAGAAATGGAACGTGAGGTGCTCTCTGATCCGCGTAACGCTGCTTTAGTACTCCGTCTACACTTCCACGACTGCTTCGTTCAG
GGA
TGCGACGGTTCGGTCCTGTTGGATGATACGGTCATGCTACGAGGAGAGAAGACAGCTTCCCCAAATATAAACTCTCTAAAAGGTTTTGAAATCATCGATAGGATCAAGAGCAATGTTGAA
TCCGAATGCCCTGGAATTGTCTCTTGCGCTGATATATTGACCATTGCTGCTAGAGATGCTGTCATTCTG
GTGGGCGGACCGTATTGGGATGTTCCGGTGGGGAGAAAAGACTCAAGAAGC
GCAAGCTACGAGCTTGCAAACACCAATATTCCTACTCCGAATCAAGGCCTCATTGCCATCATTTACAAGTTCCTTTACCTCGGCCTCTCTGTCACCGACACCGTCGCACTTTCCG
GGGCT
CACACGATCGGCGTGGCACGCTGTGAGAACTTCCGTGCAAGAATATATGGGGACTACGAATCGACGTCGGGCGGTAGTCCATTATCTGAAGTGCACCTGAGCCAATTGAAGTCCACATGC
CCGGCCGCAGGAGGGGGAGATAACAACATCGCGCCTTTGGACTACGAAACGCCCTACACGTTCGACAACTCCTACTACCATTTGCTCCTGAATGGAGAGGGATTGCTCAATTCTGACCAG
GAACTATACTCAAGTGTATTGGCCCTTCAGACCAAGCAGCTTGTGGAACAGTATGCACTTGACGTGGCAGCCTTCTTTCAGCAGTTCTCCGTTTCCATGGTAAAGATGGGGAACCTCATG
AATCCGGATAGCTTTCTCAATGGAGAAGTGAGGAAGAGTTGCAGATTCATCAATGCATGA

Retrieve as FASTA