Entry information : SbPrx86 (Sobic.005G011500.1 [2.1] / Sb05g001030 [1.4])
Entry ID 805
Creation 2006-01-02 (Christophe Dunand)
Last sequence changes 2006-01-02 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx86 (Sobic.005G011500.1 [2.1] / Sb05g001030 [1.4])
Name (synonym) SbPrx86 (Sobic.005G011500.1 [2.1] / Sb05g001030 [1.4])
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Roots
Inducers Acid treatment
Alkaline treatment
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx86
start..stop
S start..stop
SiPrx61 613 0 1..317 1..317
OsPrx131 580 0 1..317 1..317
OsPrx136 578 0 1..317 1..317
OsPrx57 464 1e-166 3..317 4..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1028708..1028917 210 N° 2 1028436..1028627 192 N° 3 1027932..1028097 166 N° 4 1027429..1027814 386
complement(join(1027429..1027814,1027932..1028097,1028436..1028627,1028708..1028 917))


exon

Literature and cross-references SbPrx86 (Sobic.005G011500.1 [2.1] / Sb05g001030 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublilshed
DNA ref. Phytozome 12:   chromosome_5 (1028917..1027429)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.3865.1
Protein sequence: SbPrx86 (Sobic.005G011500.1 [2.1] / Sb05g001030 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (294)
PWM (Da):   %s   33972.85 (31611.6)  
PI (pH):   %s   7.94 (7.70) Peptide Signal:   %s   cut: 24 range:24-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASHKPLTCSVLALFFAASLVSSQLNANFYDKSCPNALYTIQTAVRSAVARENRMGASLLRLHFHDCFVNGCDGSVLLDDTPTFTGEKTAVPNNNSLRGFDVIDSIKAQLERICPQVVSCADIVAVAARDSVVALGGPTWAVNLGRRDSLTASLDAANNDIPAPTLDLTDLTKSFSNKGLSASDMIALSGGHTIGQARCVNFRDRIYSEANIDTSLATSLKTNCPNKTGDNNISPLDASTPYVFDNFYYKNLLNKKGVLHSDQQLFNGGSADSQTTTYSSNMAKFFTDFSTAMLKMSNISPLTGSSGQIRKNCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 6 ESTs. Two partial genomic SbGSStuc11-12-04.3865.1 (3') and SbGSStuc11-12-04.6865.1 (5')
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCATAAACCCCTCACTTGCAGTGTCTTGGCCTTGTTCTTTGCTGCAAGCTTAGTTTCATCTCAGCTAAATGCAAATTTCTATGACAAGTCATGCCCAAATGCATTGTACACC
ATCCAAACAGCGGTGAGGTCGGCTGTTGCCAGGGAGAACCGCATGGGCGCATCATTGCTCCGCCTCCACTTTCACGACTGCTTTGTTAAT
GTAAGTGTCCCCAAGTCTGCACATATGTTT
TAAACTTCACATTTTCTGAATTCATAAGCATGTCAATCTTAACTATGCAGGGCTGCGATGGCTCAGTGCTGCTTGATGACACCCCAACCTTCACAGGGGAGAAGACTGCTGTTCCGAACA
ACAATTCCCTGCGTGGATTTGACGTGATTGACAGCATCAAGGCACAGCTTGAGAGGATCTGCCCACAGGTGGTATCATGTGCTGACATCGTCGCTGTGGCAGCACGTGACTCTGTTGTTG
CG
GTAAGACAGAACAAAAGAAACATTTCAAGTTAGAGGCAACAAGTTGAATGTCAAAGTGTTTATGATTGTGAACCTCACAACACCCCAACTAAGTGATTATCCAATTCTTTAACTGAAA
TGAGGATGGTACTGGTACCACTCTTTATATTTGAGAGATTATGATAAATTTATAACCTAGACCAAAACAAGCCTCAGGGAGCACTAAACTAAACTACAAAAGTCAACATTCATATTCAAA
GATTCTATAGCAACTGATTGACTAAGTGCATTTCATACATTCCAATTTAGCAATTCCAATAGAAACAAACAATAGTAAGAGTTGGAAATTTCTATTTCAGCTTGGAGGACCTACTTGGGC
TGTCAATCTGGGAAGGCGTGACTCATTGACAGCAAGCCTAGATGCTGCAAACAACGACATCCCAGCACCAACTCTTGACCTCACTGATCTCACCAAGTCCTTCTCAAACAAAGGACTGAG
TGCATCTGACATGATTGCACTCTCAG
GTACCAATTTTGTGAACAAACATATACTTGATTCATAAATCATAGTCAACTCTAGATTTGTTCCTTGAATGCAAAAGGTAGTAATACTGACTGA
TATGAAATAAAAAAAAATTCCAGGAGGTCACACCATTGGGCAAGCAAGATGTGTCAACTTCCGCGACCGCATATACAGTGAAGCTAACATCGACACGTCCCTTGCGACATCACTGAAAAC
AAACTGTCCCAACAAGACTGGTGACAATAACATTTCACCCCTTGACGCCTCGACACCCTATGTATTTGACAATTTCTACTACAAGAACTTACTGAACAAGAAGGGTGTTCTGCATTCTGA
CCAGCAACTGTTCAATGGAGGTTCAGCAGACTCCCAGACTACGACCTACTCTTCAAACATGGCAAAATTCTTCACTGATTTCAGCACGGCAATGTTGAAGATGAGCAACATTAGTCCCCT
AACTGGATCCAGTGGACAGATAAGGAAAAACTGCAGGAGGGTAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCATAAACCCCTCACTTGCAGTGTCTTGGCCTTGTTCTTTGCTGCAAGCTTAGTTTCATCTCAGCTAAATGCAAATTTCTATGACAAGTCATGCCCAAATGCATTGTACACC
ATCCAAACAGCGGTGAGGTCGGCTGTTGCCAGGGAGAACCGCATGGGCGCATCATTGCTCCGCCTCCACTTTCACGACTGCTTTGTTAAT
GGCTGCGATGGCTCAGTGCTGCTTGATGAC
ACCCCAACCTTCACAGGGGAGAAGACTGCTGTTCCGAACAACAATTCCCTGCGTGGATTTGACGTGATTGACAGCATCAAGGCACAGCTTGAGAGGATCTGCCCACAGGTGGTATCATGT
GCTGACATCGTCGCTGTGGCAGCACGTGACTCTGTTGTTGCG
CTTGGAGGACCTACTTGGGCTGTCAATCTGGGAAGGCGTGACTCATTGACAGCAAGCCTAGATGCTGCAAACAACGAC
ATCCCAGCACCAACTCTTGACCTCACTGATCTCACCAAGTCCTTCTCAAACAAAGGACTGAGTGCATCTGACATGATTGCACTCTCAG
GAGGTCACACCATTGGGCAAGCAAGATGTGTC
AACTTCCGCGACCGCATATACAGTGAAGCTAACATCGACACGTCCCTTGCGACATCACTGAAAACAAACTGTCCCAACAAGACTGGTGACAATAACATTTCACCCCTTGACGCCTCGACA
CCCTATGTATTTGACAATTTCTACTACAAGAACTTACTGAACAAGAAGGGTGTTCTGCATTCTGACCAGCAACTGTTCAATGGAGGTTCAGCAGACTCCCAGACTACGACCTACTCTTCA
AACATGGCAAAATTCTTCACTGATTTCAGCACGGCAATGTTGAAGATGAGCAACATTAGTCCCCTAACTGGATCCAGTGGACAGATAAGGAAAAACTGCAGGAGGGTAAACTAG

Retrieve as FASTA