Entry information : EgrPrx110 (Eucgr.G02398 / Egrandis_v1_0.018542m)
Entry ID 8054
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx110 (Eucgr.G02398 / Egrandis_v1_0.018542m)
Name (synonym) EgrPrx110 (Eucgr.G02398 / Egrandis_v1_0.018542m)
Class Class III peroxidase    [Orthogroup: Prx074]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx110
start..stop
S start..stop
EglPrx110 697 0 1..339 1..339
EguPrx110 656 0 1..339 1..339
EcamPrx105 569 0 1..338 1..338
EgrPrx105 568 0 1..338 1..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42554046..42554282 237 N° 2 42553675..42553866 192 N° 3 42553364..42553529 166 N° 4 42552785..42553209 425
complement(join(42552785..42553209,42553364..42553529,42553675..42553866,4255404 6..42554282))


exon

Literature and cross-references EgrPrx110 (Eucgr.G02398 / Egrandis_v1_0.018542m)
DNA ref. Phytozome 12:   scaffold_7 (42554282..42552785)
Protein sequence: EgrPrx110 (Eucgr.G02398 / Egrandis_v1_0.018542m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340 (309)
PWM (Da):   %s   36475.96 (33322.3)  
PI (pH):   %s   4.72 (4.50) Peptide Signal:   %s   cut: 31 range:31-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASIHPRVLAMQFLGAIAFISGVLRSGASDPPLTLDYYASSCPTVFDVIHKEMECAVLSDPRNAAFVVRLHFHDCFVQGCDGSVLLDDTVTLQGEKTASPNINSLDGFDIIDKIKNKVESDCPGIVSCADILTIAARDAVILVGGPYWDVPVGRKDSRTASYDLANTNIPTANEGLTSIISKFLSLGLSVTDTVALSGAHTIGMARCENYRARIYGDYESTSGGSPSSEARLSKLKSTCPAAGGGEDNIAPMDYETPNVFDNSYYHLLLNGEGLLNSDQELYSSVLAIQTKKIAVQYAHDTAAFFQQFSESMVKMGNITNSDSFVNGEVRKNCRFINT*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTTCGATTCATCCAAGAGTCCTCGCGATGCAGTTCTTGGGCGCGATCGCCTTCATTTCTGGTGTTCTACGCTCCGGTGCAAGCGACCCTCCACTGACGCTTGATTACTATGCA
TCTTCGTGCCCGACCGTGTTTGACGTCATCCATAAAGAAATGGAATGCGCGGTGCTCTCAGATCCGCGCAATGCTGCGTTTGTAGTCCGACTACACTTTCATGACTGCTTCGTCCAG
GTG
CATTGCGTATATCGTAATTCTATGCAAATTTCCATTCTCTATAGTTAAATTAAACATGTACTTGGGAATGAAAGTGGGACAATAGTGACATCAATCATGAAGCATGGATCAAACTGCAAA
GGGAGAATTCCTTTTCTTCTTTTATTTTGTAATCTTTTGGTTGCAAATTTTACTAGGGATGTGACGGTTCGGTTCTGTTAGACGATACAGTCACGCTGCAAGGAGAGAAGACAGCGTCCC
CAAATATAAACTCTCTAGATGGTTTTGATATCATCGATAAGATCAAGAACAAAGTTGAATCCGACTGCCCTGGAATTGTCTCGTGCGCTGATATATTGACAATTGCTGCTAGAGATGCGG
TCATTCTG
GTATAGATCGTCTTATTTCTCTGAATTCCTCATTTACTTGTCAAACAATGTTTTGAATTATAATCTATCTTGCTGTACTTCTTAACCAAGGAGAAATATCAGCAAATCAATG
TGATTAATATCGATTCTCTTTCGTACTTTATAGGTGGGCGGACCATATTGGGATGTTCCGGTGGGGAGGAAGGACTCGAGAACTGCAAGCTACGACCTCGCAAACACCAACATTCCAACT
GCGAACGAAGGTCTCACTTCCATCATTTCCAAGTTCCTTTCCCTCGGCCTCTCTGTCACCGACACCGTCGCGCTTTCCG
GTAATTATTTAGTTCATATTCCTCTTATGTGATTGATCAGA
TTACTTTCTCAAGTTGAGCTTACTGCCACAGATTCTAAAGCGCAATGATCAAGGCGTGTATGCTGTCAATTACGTTAAATTTTCCTTAATTATGTGCACATTCCAATCACTAGGGGCTCA
CACGATCGGCATGGCACGATGTGAGAACTACCGTGCGAGGATATACGGCGACTACGAATCAACGTCGGGCGGTAGTCCATCCTCCGAAGCACGCCTCAGCAAATTGAAGTCCACGTGCCC
AGCCGCCGGAGGGGGAGAGGACAACATCGCGCCGATGGACTACGAAACGCCCAATGTATTCGACAACTCCTACTACCACTTGCTCCTGAATGGAGAGGGATTACTTAACTCCGACCAAGA
ACTGTATTCGAGTGTATTGGCGATTCAGACCAAGAAGATTGCGGTACAGTATGCGCATGACACGGCGGCTTTCTTCCAGCAGTTCTCCGAATCCATGGTCAAGATGGGGAACATCACGAA
TTCGGATAGCTTTGTCAATGGAGAAGTGAGGAAGAACTGCAGATTTATCAATACATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTTCGATTCATCCAAGAGTCCTCGCGATGCAGTTCTTGGGCGCGATCGCCTTCATTTCTGGTGTTCTACGCTCCGGTGCAAGCGACCCTCCACTGACGCTTGATTACTATGCA
TCTTCGTGCCCGACCGTGTTTGACGTCATCCATAAAGAAATGGAATGCGCGGTGCTCTCAGATCCGCGCAATGCTGCGTTTGTAGTCCGACTACACTTTCATGACTGCTTCGTCCAG
GGA
TGTGACGGTTCGGTTCTGTTAGACGATACAGTCACGCTGCAAGGAGAGAAGACAGCGTCCCCAAATATAAACTCTCTAGATGGTTTTGATATCATCGATAAGATCAAGAACAAAGTTGAA
TCCGACTGCCCTGGAATTGTCTCGTGCGCTGATATATTGACAATTGCTGCTAGAGATGCGGTCATTCTG
GTGGGCGGACCATATTGGGATGTTCCGGTGGGGAGGAAGGACTCGAGAACT
GCAAGCTACGACCTCGCAAACACCAACATTCCAACTGCGAACGAAGGTCTCACTTCCATCATTTCCAAGTTCCTTTCCCTCGGCCTCTCTGTCACCGACACCGTCGCGCTTTCCG
GGGCT
CACACGATCGGCATGGCACGATGTGAGAACTACCGTGCGAGGATATACGGCGACTACGAATCAACGTCGGGCGGTAGTCCATCCTCCGAAGCACGCCTCAGCAAATTGAAGTCCACGTGC
CCAGCCGCCGGAGGGGGAGAGGACAACATCGCGCCGATGGACTACGAAACGCCCAATGTATTCGACAACTCCTACTACCACTTGCTCCTGAATGGAGAGGGATTACTTAACTCCGACCAA
GAACTGTATTCGAGTGTATTGGCGATTCAGACCAAGAAGATTGCGGTACAGTATGCGCATGACACGGCGGCTTTCTTCCAGCAGTTCTCCGAATCCATGGTCAAGATGGGGAACATCACG
AATTCGGATAGCTTTGTCAATGGAGAAGTGAGGAAGAACTGCAGATTTATCAATACATGA

Retrieve as FASTA