Entry information : EgrPrx100 ( Eucgr.G00658 / Egrandis_v1_0.019477m)
Entry ID 8058
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-13 (Christophe Dunand)
Peroxidase information: EgrPrx100 ( Eucgr.G00658 / Egrandis_v1_0.019477m)
Name (synonym) EgrPrx100 ( Eucgr.G00658 / Egrandis_v1_0.019477m)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx100
start..stop
S start..stop
EglPrx100 655 0 1..324 1..324
EguPrx100 650 0 1..324 1..324
EcamPrx100 628 0 1..324 1..317
CclPrx116 475 1e-170 11..311 8..308
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11400166..11400375 210 N° 2 11399819..11400001 183 N° 3 11399387..11399549 163 N° 4 11397144..11397562 419
complement(join(11397144..11397562,11399387..11399549,11399819..11400001,1140016 6..11400375))


exon

Literature and cross-references EgrPrx100 ( Eucgr.G00658 / Egrandis_v1_0.019477m)
DNA ref. Phytozome 11:   scaffold_7 (11400375..11397144)
Protein sequence: EgrPrx100 ( Eucgr.G00658 / Egrandis_v1_0.019477m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (301)
PWM (Da):   %s   35364.54 (32779.3)  
PI (pH):   %s   4.84 (4.92) Peptide Signal:   %s   cut: 24 range:24-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDLELSRVLALLAYCCLMGTGNAQLRFGFYGQTCPSAEPIVRSVVRNAVISNPNMAAILLRLHFHDCFVEGCDGSILIENGRSAERNAFGHQGVGGFEVIEEAKKHLEVTCPGVVSCADIVALAARDAVAMANGPDYEVPTGRRDGRVSNVSLAEDMPDVGNSIQQLKSKFFQKGLTEKDLVLLSAAHTIGTTACFFMTDRLYNFMPGGGSDPSINPDFLPELKSMCPQNGDVNVRMPIDHGSEQTFDDQILRNIRSGWAILESDAKLNDDPVTRSVIESYVGLFNPIFGPSFEAEFVESMVKMGQIGVKTRVKWRDQAGLQIF

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). GEIR is missing but present in another frame
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCTAGAACTCTCACGGGTTCTTGCACTACTCGCTTATTGTTGCTTGATGGGAACGGGTAATGCGCAGCTCAGATTCGGTTTCTACGGCCAAACCTGCCCTTCTGCCGAGCCCATA
GTGAGATCCGTCGTTCGAAATGCGGTCATCTCCAACCCCAACATGGCCGCCATCTTGCTTCGCCTTCACTTCCATGACTGCTTTGTCGAG
GTCTCTCTCTCGCTCAATATGCTCTGCTTT
CCTCATATCATGACTAGTAATGCTTCAAAAGTTGAAAGATTCTTGATAGATAAATGCTCTTGAATAAGACCCTTTTATCTAGGAATGAGACTGTTAAGGTCGATCTTGTGATTTTGATGC
TATGTATCTTTTAGGGATGTGATGGTTCGATTCTTATAGAGAACGGGCGAAGTGCGGAGAGGAATGCGTTCGGGCACCAAGGGGTGGGCGGATTTGAGGTGATCGAGGAAGCCAAGAAGC
ACCTCGAGGTCACTTGCCCCGGTGTCGTCTCGTGCGCCGACATTGTTGCCTTAGCGGCTAGAGATGCTGTCGCAATG
GTTCGCCTCTCTTTTATTTGTGTTCTCTTGATTTGCACATATA
TATTAGTTGTCTGTTTAGGATGATCATATATGGATGTACCATGAGTCAATTATCTAGTATGCCTAGGATGGATTTTTCGTATACTCATGAATCAGTATCATGATTGAATATGAATTCCGA
ATAGAATGATGCGCGAAATTAGTACAATGGCCGGATAATTGTTACAAACTGAATTTATGAAGTGACATGACAAATTGACAACACACTTATATTAATGTGTGTGAAGGCAAATGGGCCTGA
TTATGAGGTTCCGACGGGGCGCCGGGATGGGAGGGTGTCAAATGTGTCGCTGGCCGAGGACATGCCGGACGTCGGCAACTCCATCCAACAGCTCAAGTCCAAGTTCTTCCAGAAAGGCCT
CACCGAAAAGGACCTCGTCCTCCTAAGCG
GTACAGCCCCTCTCTCTCTCTCTACCACTCTCTCTCTCCCTCTACCCATGCTGATATGATGAGCTGATGTTGGTTTGGAAGCCTAAAAAAC
ATGAAAAAGGTGTCATCAATCGTCATGTTGGAGCATCAAAATTAGAATTTCGTTTGGCTGGTTTTAGGTGGGTAAGAAACAGATTATTCTACTCACATTCTCAACTACATACAATGACAC
ATCCTTCAACGATGACTCTTTGTAATTAGGCTTGTAATCCAATTTCACAATTCTTAAAATCGTCCAAGACTACAAGGATTGGGAAAAATTACGAAAAATGTTAGGAATATATTGTACAAA
TACCAAATCAATCATAAACTTTTCAATTTGGTCAATTTAATCATAAACCTTTTAAGCATATGTCAATATTCCATCCAAATTTGGCTAGATCTTATTGATATAGACGCCAAAGGTCCTACG
TGACACAGTTGACGCTAACATGTACAATTATTTTGCATTTTTAATTTTTTTTCTTTTTTTTTTCTTTTCTTTTCTTTTTGTTTCTTTCTCTTTCTTACGGCCTCGTTATTAAATAATAAA
AAAATCCAAAACACTGCAAAAATCATCTATGTTAGTGCCAGTTGTGGCATATAAGGCAAATGTCATTTATATTAGTAATTTCCAACCAAAATTGGCCGGAATGACTAAATTAACAAATTG
TCCAAAGGTTTATTACTATGTTGACTAAATTGAAAAGTTTAAGACTAGATTGACATCCACATATTTTTTGGTAATTATCTTATAGTAAATTAATATTAGAGATGAGCGGTTTTAAGCTCC
ATACAAGTTCCACTTGAAACCTAGAATTTGGAACATATCCATTTAAATAGATTTCTCATTTTCTAGAACTTAAAATCTATCATGGGGACTTTGGAACCTAGAACCCATCTTATCACAGAT
TCTAAAGTTAGTTCCAAGATCTACATAAGTTTCACCTTTATTATTAATAGGATAATTGCAATAAATTATCACTTTTAATAATCGTCAATTGTTGCCACAATCTATCAATCATAATTTATA
TTTGGATACACGAAAAATATGAAATATTATAAAGTAAATGTTTTAATCATAAAATAGAAGCTCAGACTAGTGATCCCAGATTATACATTCATAATCAAATGCCATAGAATACTACAAGAT
CGTGCAAAAACATAGCCAAGAAAAACATAGAAATTCATTTTGGATTCCAAGTTTTGGGTTTTGGGTTTTGGGTTTAAGGTTCAAAGTTTCATTAACCTAGAATTTAGGACCTACTCATCG
AAACATAATTTTCAATTTTTGAAACCTGAAACTACCCTGCATACCTTGAAATCTAGAACTTAACATGTTATTACCATTGGTTCAGTTCTTAGATTTTAGGTTCTACCCCAAAACCATATC
TATCCCTAATTGATATAATGGCCGTGTTATGTGGTCTCTCTTGCTTCCATATATCATCAAAAATTTCTTTCCTTAAGCTAAGTATGTACTTACAACTTCATTTTTTTTAAATATAAATAT
TTTTAATATAATTTTAAAAGTTCATATAGTGTTATATGTGAATATTTTTTTAGGTATTCGGTATTAAATATCGAATCCTAAAGAATAAAGAGATAGTAACAATGGCAATGGCTTGAACTC
CACATTGATTTCTCCTGAACCATGAACCAACTTGAGATTATTCAAGTAAACCTAAGCTGACTTCGTTTATTGAATGAAACAGGGTCGCTTGTTTTAAGTGTCTAATAGGACTGATTAATT
AAGAAAACAAATTTGTGAATCTCTGATATTCACTTCCAATTTTCATGTTGCAGCCGCGCATACCATCGGAACCACCGCATGCTTCTTCATGACGGACCGTCTGTACAACTTCATGCCCGG
CGGCGGATCGGACCCTTCGATCAACCCCGACTTCTTGCCGGAGCTAAAGTCAATGTGCCCGCAGAACGGCGACGTGAATGTGCGGATGCCAATCGATCACGGCAGCGAGCAGACATTCGA
CGACCAGATCCTCCGGAACATCAGGAGCGGATGGGCCATTTTGGAGTCGGACGCGAAGCTAAATGACGACCCGGTGACGCGGAGCGTGATCGAATCTTACGTGGGTCTCTTCAACCCGAT
CTTCGGGCCTTCCTTCGAAGCGGAATTCGTCGAATCAATGGTAAAAATGGGACAGATCGGTGTCAAGACGAGGGTCAAATGGAGAGATCAGGCGGGTTTGCAGATCTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCTAGAACTCTCACGGGTTCTTGCACTACTCGCTTATTGTTGCTTGATGGGAACGGGTAATGCGCAGCTCAGATTCGGTTTCTACGGCCAAACCTGCCCTTCTGCCGAGCCCATA
GTGAGATCCGTCGTTCGAAATGCGGTCATCTCCAACCCCAACATGGCCGCCATCTTGCTTCGCCTTCACTTCCATGACTGCTTTGTCGAG
GGATGTGATGGTTCGATTCTTATAGAGAAC
GGGCGAAGTGCGGAGAGGAATGCGTTCGGGCACCAAGGGGTGGGCGGATTTGAGGTGATCGAGGAAGCCAAGAAGCACCTCGAGGTCACTTGCCCCGGTGTCGTCTCGTGCGCCGACATT
GTTGCCTTAGCGGCTAGAGATGCTGTCGCAATG
GCAAATGGGCCTGATTATGAGGTTCCGACGGGGCGCCGGGATGGGAGGGTGTCAAATGTGTCGCTGGCCGAGGACATGCCGGACGTC
GGCAACTCCATCCAACAGCTCAAGTCCAAGTTCTTCCAGAAAGGCCTCACCGAAAAGGACCTCGTCCTCCTAAGCG
CCGCGCATACCATCGGAACCACCGCATGCTTCTTCATGACGGAC
CGTCTGTACAACTTCATGCCCGGCGGCGGATCGGACCCTTCGATCAACCCCGACTTCTTGCCGGAGCTAAAGTCAATGTGCCCGCAGAACGGCGACGTGAATGTGCGGATGCCAATCGAT
CACGGCAGCGAGCAGACATTCGACGACCAGATCCTCCGGAACATCAGGAGCGGATGGGCCATTTTGGAGTCGGACGCGAAGCTAAATGACGACCCGGTGACGCGGAGCGTGATCGAATCT
TACGTGGGTCTCTTCAACCCGATCTTCGGGCCTTCCTTCGAAGCGGAATTCGTCGAATCAATGGTAAAAATGGGACAGATCGGTGTCAAGACGAGGGTCAAATGGAGAGATCAGGCGGGT
TTGCAGATCTTTTAA

Retrieve as FASTA